<?xml version='1.0' encoding='UTF-8'?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.1d1 20130915//EN" "JATS-journalpublishing1.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink">
  <front>
    <journal-meta id="journal-meta-1">
      <journal-id journal-id-type="nlm-ta">Biomedical Research and Therapy</journal-id>
      <journal-id journal-id-type="publisher-id">Biomedical Research and Therapy</journal-id>
      <journal-id journal-id-type="journal_submission_guidelines">http://bmrat.com/</journal-id>
      <journal-title-group>
        <journal-title>Biomedical Research and Therapy</journal-title>
      </journal-title-group>
      <issn publication-format="print"/>
    </journal-meta>
    <article-meta id="article-meta-1">
      <article-id pub-id-type="doi"> 10.15419/bmrat.v12i2.960</article-id>
      <title-group>
        <article-title id="at-c4b9aeba1645">Cytotoxicity and antiproliferative activity of <italic id="e-6a5cc97eaf33">Arctium lappa</italic> extract on an <italic id="e-a4fa89fe5b38">in vitro</italic> model of human colorectal cancer</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author" corresp="yes">
          <contrib-id contrib-id-type="orcid">0000-0002-3760-1235</contrib-id>
          <name id="n-bda81a228414">
            <surname>Hassan</surname>
            <given-names>Amal I.</given-names>
          </name>
          <email>virtualaml@gmail.com</email>
          <xref id="x-1256e4a40377" rid="a-5a1761685bc6" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-3bbd26f6e5e8">
            <surname>Bondouk</surname>
            <given-names>Ibrahim I.</given-names>
          </name>
          <xref id="x-ae8274eac891" rid="a-7269425f69b7" ref-type="aff">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-1636d84b2aba">
            <surname>Abdelrahman</surname>
            <given-names>Mohamad Taha</given-names>
          </name>
          <xref id="x-fac5e612fbe7" rid="a-5a1761685bc6" ref-type="aff">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <contrib-id contrib-id-type="orcid"/>
          <name id="n-0203c51da1e3">
            <surname>Saleh</surname>
            <given-names>Hosam M.</given-names>
          </name>
          <xref id="x-0840e3336856" rid="a-5a1761685bc6" ref-type="aff">1</xref>
        </contrib>
        <aff id="a-5a1761685bc6">
          <institution>Department of Radioisotopes, Nuclear Research Centre, Egyptian Atomic Energy Authority, Egypt </institution>
        </aff>
        <aff id="a-7269425f69b7">
          <institution>Physics Department, Faculty of Science, University of Tanta, Tanta, Egypt</institution>
        </aff>
      </contrib-group>
      <volume>12</volume>
      <issue>2</issue>
      <fpage>7153</fpage>
      <lpage>7167</lpage>
      <permissions/>
      <abstract id="abstract-c34d048c5ce1">
        <title id="abstract-title-700c0c82d2d9">Abstract</title>
        <p id="p-10e420bf9a71"><bold id="s-10d56cb13067">Background</bold>: Natural remedies are an excellent source for screening innovative and safe anti-cancer medicines. This study is intended to explore the potential toxicity of burdock seed extract, <italic id="e-2cd9062257a6">Arctium lappa</italic> (<italic id="e-e29a28a83c7b">A. lappa</italic>), as well as its anti-regenerative and anti-proliferative effects on tumor cells <italic id="e-56752afca80a">in vitro</italic>. <bold id="s-25188bc6a3a7">Methods</bold>: The antiproliferative effect of <italic id="e-9556ea23f85f">A. lappa</italic> ethanol extract (EtOH) was evaluated on human colorectal carcinoma (H-COLO-205) cells and normal skin fibroblast (HSF) cell lines using the SRB assay. Matrix metalloproteinases (MMP-2 and MMP-9) and apoptotic gene expressions (<italic id="e-5dc34ab31f76">e.g</italic>., BAX, BCL-2, P53) were analyzed using Western blot and qRT-PCR, respectively. <bold id="s-2d5464b7f9a0">Results</bold>: <italic id="e-f85376c84ecb">A. lappa</italic> inhibited H-COLO-205 cell growth with an IC₅₀ of 11.80 µg/mL while sparing normal HSF cells (IC₅₀ = 1485 µg/mL). The extract significantly increased pro-apoptotic gene expression, with upregulation of <italic id="e-c246aee64492">caspase-3</italic> (4.07-fold), <italic id="e-f00780e2163f">caspase-9</italic> (3.66-fold), <italic id="e-251f7ccb96dc">P53</italic> (2.69-fold), and <italic id="e-4dc0eed32f8b">BAX</italic> (22.44-fold), and downregulated the anti-apoptotic gene <italic id="e-8775ac414c35">BCL-2</italic> by 13.33-fold. Migration assays showed that <italic id="e-0ad3428e1854">A. lappa</italic> reduced MMP-2 and MMP-9 protein levels by 1.36-fold and 1.34-fold, respectively. The extract also downregulated NF-κB expression and significantly decreased the levels of inflammatory cytokines IL-6, IL-1β, and TNF-α. Furthermore, <italic id="e-81b470f3ec64">A. lappa</italic> enhanced DNA fragmentation, with a 4.36% increase in comet tail migration and an 18.88 tail moment at a 100 µg/mL concentration. Molecular docking revealed that arctigenin, a major compound in <italic id="e-8317c1eaa622">A. lappa</italic>, forms stabilizing hydrogen bonds with TGF-βR1, inhibiting its kinase function and associated cancer pathways. <bold id="s-559afb8862e5">Conclusion</bold>: These results indicate that <italic id="e-c5d296311991">A. lappa</italic> may serve as a promising plant-derived anticancer medication for colon cancer.</p>
      </abstract>
      <kwd-group id="kwd-group-1">
        <title>Keywords</title>
        <kwd>Cancer cells</kwd>
        <kwd>antiproliferative</kwd>
        <kwd>burdock</kwd>
        <kwd>anticancer</kwd>
        <kwd>apoptosis</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec>
      <title id="t-cbba930df241">Introduction</title>
      <p id="p-83846796a9a6">Colorectal cancer poses a significant global health concern, with more than 1.5 million new cases reported worldwide in 2018. This number is projected to rise by 60% by the year 2030<bold id="s-109204300df1"><xref id="x-e502b518857a" rid="R263386632911305" ref-type="bibr">1</xref></bold>. The effectiveness of chemotherapy in treating cancer is limited due to issues such as toxicity and tumor resistance. However, <italic id="e-adcc8dd92b2e">A. lappa</italic> seeds offer a promising solution as they contain essential oils, lignans, chlorogenic acid, and vitamins, including the potent antitumor compound arctigenin<bold id="s-ef35a6c8880b"><xref rid="R263386632911306" ref-type="bibr">2</xref>, <xref rid="R263386632911307" ref-type="bibr">3</xref></bold>. Recent research demonstrates that several plant extracts, such as alkaloids, flavonoids, and polyphenols, which have a high molecular weight, could prove effective in the therapy of human multiple myeloma (HMM)<bold id="s-0d0e761d8f3f"><xref id="x-c00820d46260" rid="R263386632911308" ref-type="bibr">4</xref></bold> and bone marrow (HBM8-k562) cells<bold id="s-94bf967919e3"><xref id="x-7b3bb66bf546" rid="R263386632911309" ref-type="bibr">5</xref></bold>. These compounds also showed antitumor activity against aggressive malignancies of the liver (Huh-7), oral cavity (HTB-43), and bladder (ECV304)<bold id="s-1f91f1741506"><xref id="x-6337cc542a2a" rid="R263386632911310" ref-type="bibr">6</xref></bold>.</p>
      <p id="p-dc57cfe8684c">In this study, we aim to find out the effects of <italic id="e-d1650f27cf7c">A. lappa</italic> extract on human colorectal cancer cells, specifically the cell line Colo-205. This research specifically aims to determine (1) the cytotoxicity of A. lappa extract on Colo-205 cells, (2) its effect on cell proliferation and migration, and (3) to explore the molecular mechanisms behind its antiproliferative and pro-apoptotic effects using <italic id="e-dcf96213253e">in vitro</italic> assays and molecular docking techniques.</p>
      <p id="p-553671a653b6"/>
    </sec>
    <sec>
      <title id="t-a98e6f06b463">Methods</title>
      <sec>
        <title id="t-bee4cea51d17">Chemicals and Reagents</title>
        <p id="p-81a2d19ef724">The chemicals and reagents used in this research were of high purity. Ethanol (≥ 99.8%), methanol (≥ 99.9%), and acetonitrile (HPLC grade, ≥ 99.9%) were from Sigma-Aldrich, St. Louis, MO, USA. Potassium persulfate, trichloroacetic acid (TCA), aluminum chloride, sodium carbonate, and Folin-Ciocalteu reagent were from Merck, Darmstadt, Germany. Trypan blue dye (0.4%) and phosphate-buffered saline (PBS) were from Gibco (Thermo Fisher Scientific, USA). All solvents used in HPLC analysis were ≥ 99.8% pure and from Fisher Scientific (Waltham, MA, USA), including ethyl acetate and ethyl ether. The HPLC standards, which include cinnamic acid, benzoic acid derivatives, and gallic acid, came from Sigma-Aldrich with a purity of ≥ 98%.</p>
        <p id="p-84ac9b427a82">The chemicals used for preparing proteins and for Western blotting, such as acrylamide, bis-acrylamide, SDS, TEMED, ammonium persulfate, and Tris-HCl, were purchased from Bio-Rad, Hercules, CA, USA. ELISA kits for cytokine studies were from R&amp;D Systems, Minneapolis, MN, USA. All chemicals used for the comet assay, including ethidium bromide, Triton X-100, and sodium lauroyl sarcosinate, were from Sigma-Aldrich.</p>
      </sec>
      <sec>
        <title id="t-5feea6836d29">Plant Seeds Collection</title>
        <p id="p-3bc3b388e730">In April 2019, <italic id="e-89efa8a2d749">A. lappa</italic> seedlings were obtained from Tanta University's medicinal plant garden in Tanta, Egypt. Ethanol extraction was performed on powdered <italic id="e-f054c35144de">A. lappa</italic> seeds, yielding dark brown residues.</p>
      </sec>
      <sec>
        <title id="t-d260db3bf29c">Phenolic Acids Profile in <italic id="e-48d3ae9f3404">A. Lappa</italic> by HPLC</title>
        <p id="p-0e68d390fa06">A 1 g sample was transferred into a conical flask equipped with a quick-fit system, followed by the addition of 20 mL of 2 M NaOH. The flask was flushed with nitrogen gas, sealed, and shaken for 4 hours at room temperature. The pH was adjusted to 2 using 6 M HCl. After centrifugation at 5000 rpm for 10 minutes, the supernatant was removed. Phenolic compounds were extracted in two stages using 50 mL of a 1:1 solution of ethyl acetate and ethyl ether. The organic layer was isolated and evaporated at 45°C, and the residue was dissolved in 2 mL of methanol<bold id="s-823c82d9b30a"><xref id="x-c87817807776" rid="R263386632911311" ref-type="bibr">7</xref></bold>. An Agilent 1260 series HPLC system was utilized for analysis, employing a Zorbax Eclipse Plus C8 column. The mobile phase consisted of acetonitrile (solvent A) and a 2% acetic acid solution in water (v/v) (solvent B). The flow rate was maintained at 0.8 mL/min over a 70-minute run. The gradient program was as follows: 100% solvent B reduced to 85% over 30 minutes, then to 50% over the next 20 minutes, followed by a drop to 0% in 5 minutes, and finally returned to 100% B in the last 5 minutes. A 50 µL injection volume was used, and peaks for cinnamic acid and benzoic acid derivatives were monitored concurrently at 280 nm and 320 nm. Samples were filtered through a 0.45 µm syringe filter before injection. Peaks were identified by matching retention times and UV spectra with standards.</p>
      </sec>
      <sec>
        <title id="t-fcd5962902b3">Total Flavonoid Content (TFC) in <italic id="e-803a4f61f27e">A. Lappa</italic> Ethanolic Extract</title>
        <p id="p-c329edf9b147">To assess the total flavonoid content, the aluminum chloride assay was utilized<bold id="s-ee6d8e359d21"><xref id="x-aa6a5950abe1" rid="R263386632911312" ref-type="bibr">8</xref></bold>. Samples (500 µL in tubes) at a 1 mg/mL concentration were prepared, followed by the addition of 0.1 mL of 1 M potassium acetate solution, 0.1 mL of 10% aluminum chloride solution, 1.5 mL of methanol, and 2.8 mL of distilled water. After a 30-minute incubation at room temperature, absorbance was measured at 415 nm using a spectrophotometer.</p>
      </sec>
      <sec>
        <title id="t-f7d8503a58a9">Total Phenol Content in <italic id="e-19e72beff19d">A. Lappa</italic> Ethanolic Extract</title>
        <p id="p-1523f2cfc485">The Folin-Ciocalteu reagent was employed to quantify the phenol content in the samples, following a previously established method<bold id="s-3c5934c20735"><xref id="x-587d472d7305" rid="R263386632911313" ref-type="bibr">9</xref></bold>. In our procedure, 1 mL of the extract was mixed with 5 mL of tenfold-diluted Folin–Ciocalteu reagent and 4 mL of sodium carbonate solution (75 g/L). After incubating the mixture for 30 minutes at room temperature, the absorbance was measured at 765 nm using a spectrophotometer. Gallic acid was used as the standard for calibration, and the total phenolic content was expressed in milligrams of gallic acid equivalents (GAE) per gram of extract.</p>
      </sec>
      <sec>
        <title id="t-b9277781b999">Free Radical Scavenging</title>
        <p id="p-c12919e54fa4">The DPPH assay was conducted to measure the antioxidant capacity of <italic id="e-6f98630e6210">A. lappa</italic> extract<bold id="s-69b26733a222"><xref id="x-4da68332f0f9" rid="R263386632911314" ref-type="bibr">10</xref></bold>. Samples (at 6–200 µg/mL) were mixed with 100 µL of 1,1-diphenyl-2-picrylhydrazyl (DPPH) to achieve a final DPPH concentration of 100 µM. Absolute methanol served as the negative control. After incubation at 37°C, absorbance was measured at 512 nm using a UV-Vis Spectrophotometer 2401PC (Shimadzu, Japan). Ascorbic acid (Vitamin C) was used as a standard.</p>
      </sec>
      <sec>
        <title id="t-efad400f88f9">ABTS˙⁺ [2, 2′-azino-bis (3-ethylbenzothiazoline-6-sulfonic acid)] Radical Scavenging Activity</title>
        <p id="p-a7a3ea23c3ff">The ABTS test was used to determine the radical scavenging activity of <italic id="e-8d4d29ec98b6">A. lappa</italic> extract<bold id="s-b10d398e842f"><xref id="x-4d762b589484" rid="R263386632911315" ref-type="bibr">11</xref></bold>. This method involves the generation of the ABTS radical cation (ABTS˙⁺) by the oxidation of ABTS with an oxidizing agent, typically potassium persulfate. The resulting ABTS˙⁺ is a stable, blue-green chromophore that absorbs light at a wavelength of approximately 734 nm.</p>
        <p id="p-0dffb1806ccd">In this study, the ABTS assay was employed to determine the radical scavenging capacity of <italic id="e-0eedc507d7fd">Arctium lappa</italic> extract. The extract was introduced to the ABTS˙⁺ solution, and its antioxidant compounds reduced the radical cation, leading to a decrease in absorbance at 734 nm. This reduction is directly proportional to the antioxidant activity of the sample. The results were likely quantified as a percentage of radical scavenging activity or compared to a standard antioxidant, such as Trolox, to calculate the Trolox Equivalent Antioxidant Capacity (TEAC).</p>
        <p id="p-dce61d5bbc41">The method is valued for its sensitivity and ability to measure the antioxidant capacity of both hydrophilic and lipophilic compounds, making it suitable for diverse biological extracts like <italic id="e-ae6219771342">A. lappa</italic>.</p>
      </sec>
      <sec>
        <title id="t-2c3eff1979bb">Reducing Power (RP) of <italic id="e-9b70d6540446">Arctium lappa</italic> Ethanol Extract</title>
        <p id="p-16d12866ca11">The RP test was conducted to determine the reducing power of <italic id="e-2cc16175e97c">A. lappa</italic> extract<bold id="s-2848da463262"><xref id="x-cd006b00a942" rid="R263386632911316" ref-type="bibr">12</xref></bold>. This method works on the principle that antioxidants can reduce ferric ions (Fe³⁺) to ferrous ions (Fe²⁺), which then form a colored complex with ferricyanide. The intensity of this color is directly proportional to the sample's reducing power and can be quantified spectrophotometrically.</p>
        <p id="p-98660612200c">To assess the reducing power of the ethanol (EtOH) extract of <italic id="e-dd881944edcc">Arctium lappa</italic>, the assay was conducted using standard reagents and procedures. Phosphate buffer (0.2 M, pH 6.6) was prepared to maintain optimal pH conditions for the reaction, and potassium ferricyanide [K₃Fe(CN)₆] was used as the electron acceptor. Trichloroacetic acid (TCA, 10%) was employed to terminate the reaction, while ferric chloride (FeCl₃, 0.1%) was added to detect the presence of ferrous ions. Varying concentrations of the <italic id="e-b62110db96bf">A. lappa</italic> ethanol extract (<italic id="e-3fe8803843fc">e.g</italic>., 20–100 µg/mL) were mixed with 2.5 mL of phosphate buffer and 2.5 mL of potassium ferricyanide solution. These mixtures were incubated at 50°C for 20 minutes to allow for the reduction of ferricyanide to ferrocyanide.</p>
        <p id="p-32f2f565db71">After the incubation, the reaction was halted by adding 2.5 mL of TCA, and the mixtures were centrifuged at 3000 rpm for 10 minutes to separate the supernatant. A 2.5 mL aliquot of the supernatant was combined with 2.5 mL of distilled water and 0.5 mL of 0.1% ferric chloride solution. This mixture was allowed to stand for 10 minutes to develop the characteristic color of the reaction. The absorbance of the resulting solution was measured at 700 nm using a UV-Vis spectrophotometer. A higher absorbance indicated greater reducing power, which reflects the antioxidant capacity of the <italic id="e-af028f7b9542">A. lappa</italic> extract.</p>
        <p id="p-120d783d5979">The assay included ascorbic acid as a positive control for comparison and a blank sample, containing all reagents except the extract, as a negative control. The reducing power of the <italic id="e-a204e4a311fc">A. lappa</italic> ethanol extract was expressed as absorbance values at 700 nm. Results were plotted as a function of extract concentration, with a higher slope indicating stronger reducing activity. Furthermore, the reducing power of the extract was compared to ascorbic acid to evaluate its relative antioxidant capacity.</p>
        <p id="p-7edeeb405991">The results of the RP assay demonstrated that the ethanol extract of <italic id="e-496f5a4624e4">Arctium lappa</italic> possesses notable electron-donating properties, indicative of its potential as a natural antioxidant source. These findings suggest that <italic id="e-46d4b6062a93">A. lappa</italic> extract has promising therapeutic applications due to its antioxidant properties.</p>
      </sec>
      <sec>
        <title id="t-a941f819ce05">Cell Culture</title>
        <p id="p-ede8017e77f4">This study utilized COLO-205 (human colorectal cancer) and normal skin fibroblast cell lines (HSF), both obtained from Nawah Scientific Inc. (Egypt). All experiments were conducted in accordance with institutional biosafety guidelines in a certified laboratory facility. As this research employed only commercially available cell lines and plant extracts, no specific ethical approval for human or animal subjects was required.</p>
        <p id="p-2fff69d4a722">The cells were cultured within RPMI medium with streptomycin, penicillin, and fetal bovine serum at 37°C within a CO<sub id="s-ff67591ebcbf">2</sub>-rich atmosphere. All cell testing was conducted in a laminar flow hood, with only sterilized instruments coming into direct contact with the cells. After the cells had achieved 80-90% confluence for 2 days, the culture was renewed. For splitting, the media was aspirated, and the cells underwent three washes utilizing phosphate-buffered saline with a pH of 7.4. PBS was removed from the flasks, and 0.025% trypsin-EDTA was added. Flasks were incubated for 3-5 minutes in the incubator before cells were released. Cells were diluted to the desired concentration and cultured in fresh flasks.</p>
      </sec>
      <sec>
        <title id="t-bab041a00768">Cell Count</title>
        <p id="p-946f7bec7756">Trypan blue staining and hemocytometer counting were performed to determine cell viability and density<bold id="s-a63f2b3e0f52"><xref id="x-46db598c5438" rid="R263386632911317" ref-type="bibr">13</xref></bold>. This method is widely used to assess the health of cells in culture by distinguishing live cells from dead cells based on membrane integrity. Trypan blue selectively stains dead cells with compromised membranes, while viable cells remain unstained.</p>
        <p id="p-6f4be3749d66">The process began with the preparation of materials and reagents. Trypan blue dye (0.4%) was used for staining, while phosphate-buffered saline (PBS) was employed for washing the cells before counting. A hemocytometer (Neubauer chamber) and a light microscope were used for manual cell counting. Cells were harvested from the culture flask using appropriate methods. Adherent cells were detached enzymatically using trypsin-EDTA while suspension cells were directly collected. The cell suspension was centrifuged at 300 g for 5 minutes, and the supernatant was discarded. The pellet was resuspended in 1 mL of fresh culture medium or PBS.</p>
        <p id="p-f41bfc9788e3">For staining, 10 µL of the cell suspension was mixed with 10 µL of Trypan blue dye to create a 1:1 dilution. The mixture was gently pipetted to ensure even distribution of the dye and incubated at room temperature for 1–2 minutes. A cleaned hemocytometer was prepared by placing a coverslip over the counting grid, and 10 µL of the stained cell suspension was carefully loaded into one of the chambers, ensuring no bubbles or overfilling occurred.</p>
        <p id="p-f9deb494c3af">The hemocytometer was placed under a light microscope at 10× magnification. The total number of live and dead cells was recorded. Cell concentration was calculated using the formula:</p>
        <p id="p-708a4eafbbbc">Cell concentration (cells/mL) = (Average number of cells per quadrant × Dilution factor × 10⁴) / Volume of quadrant (0.1 mm³)</p>
        <p id="p-e1500e527a61">The percentage of cell viability was determined by dividing the number of viable cells by the total number of cells and multiplying by 100. The results included the total number of live, dead, and total cells per mL, along with the viability percentage, providing essential data on the health of the cell culture. These metrics guided experimental planning, such as determining the seeding density for further applications.</p>
      </sec>
      <sec>
        <title id="t-86d30689fc0a">Cytotoxicity Assay </title>
        <p id="p-be91377698d0">The sulfate-reducing bacteria (SRB) test was conducted to assess cell survival following exposure to <italic id="e-4f80a9e14a5b">A. lappa</italic> extract<bold id="s-c1a2994f691e"><xref id="x-79755ae583b2" rid="R263386632911318" ref-type="bibr">14</xref></bold>. In 96-well plates, 100 µL of a cell suspension (5 × 10³ cells) was added to the complete medium and incubated for 24 hours. A second aliquot of 100 µL of media containing <italic id="e-330aaddc5ccd">A. lappa</italic> methanolic seed extract was applied to the cells. Cisplatin (CP) was used as a reference drug at varying concentrations (0.01, 0.1, 1, 10, and 100 µg/mL). After 72 hours of treatment, the cells were harvested by replacing the culture media with 150 µL of 10% trichloroacetic acid (TCA) and incubating at 4 °C for 1 hour. Following TCA removal, the cells were washed five times with distilled water.</p>
        <p id="p-5ff69c74b796">Next, 70 µL of 0.4% (w/v) SRB solution was added, and the cells were incubated in darkness at room temperature for 10 minutes. The plates were washed three times with 1% acetic acid and allowed to air dry overnight. The bound SRB stain was dissolved in 150 µL of TRIS buffer (10 mM), and absorbance was measured at 540 nm using a BMG LABTECH® FLUOstar Omega microplate reader (Ortenberg, Germany).</p>
      </sec>
      <sec>
        <title id="t-ab638bf29c6a">Western Blotting of MMP-2 &amp; MMP-9 </title>
        <p id="p-a7229985cfef">Western blotting was conducted to analyze the expression levels of MMP-2 and MMP-9. Protein concentrations were determined using the Bradford method<bold id="s-49d262ef7213"><xref id="x-0e3470a1edce" rid="R263386632911319" ref-type="bibr">15</xref></bold>. Standard Western blotting procedures were followed. Proteins (30 µg per lane) were separated on a 10% SDS-PAGE gel using a non-continuous buffer system. The separating gel contained 10% acrylamide-bisacrylamide (30:0.8 ratio), 0.1% SDS, 0.05% TEMED, 0.05% ammonium persulfate, and 375 mM Tris-HCl (pH 8.8). The stacking gel (4%) was formulated with 0.5 M Tris-HCl (pH 6.8). Electrophoresis was performed at 75 V through the stacking gel and 125 V through the resolving gel for approximately 2 hours. A PageRuler™ Unstained Broad Range Protein Ladder (Thermo Scientific™, Catalog No. 26630) was used as the molecular weight marker.</p>
        <p id="p-677da8450b27">Following electrophoresis, proteins were transferred to Hybond™ nylon membranes (GE Healthcare) and blocked with 2–5% nonfat dry milk in Tris-buffered saline (TBS, pH 7.4, containing 25 mM Tris, 150 mM NaCl, and 0.1% Tween® 20 [TBST]) for 1 hour at room temperature. The membranes were incubated overnight at 4 °C with primary antibodies against MMP-2 (ab86607, Abcam, 1:1000 dilution, 73 kDa) and MMP-9 (ab228402, Abcam, 1:1000 dilution, 78 kDa).</p>
        <p id="p-88e1c7df1e2b">After three washes with TBST, the membranes were treated with horseradish peroxidase (HRP)-conjugated secondary antibody (0.1–0.5 µg/mL) for 1 hour at room temperature. β-actin was used as a loading control. Enhanced chemiluminescence (ECL) reagents (Amersham Biosciences) were used to detect the immunoreactive bands. The detected bands were quantified using Totallab analysis software (Version 1.0.1), with band intensities normalized to β-actin and expressed as a percentage of the control.</p>
        <p id="p-53028b4f3606">Finally, the protein bands were visualized and quantified using the ChemiDoc XRS imaging system (Bio-Rad Laboratories, USA) after three washes in TBST. Tween is a registered trademark of ICI Americas.</p>
      </sec>
      <sec>
        <title id="t-862d71f401ad">Gene Expression of <italic id="e-c9eccb1b33a1">BCL2</italic>, <italic id="e-3cfb1aa90f18">BAX</italic>, and <italic id="e-3d7894b40d46">P53</italic></title>
        <p id="p-32ac17366871">Total RNA was extracted from cell homogenates using the RNeasy Purification Kit (Qiagen, Valencia, CA, USA). Briefly, the cell homogenates were prepared by lysing the cells in the lysis buffer of the kit. The buffer contains guanidine isothiocyanate that enhances RNA protection and protein denaturation, yielding a high RNA output in purity and quantity. The homogenized lysate was transferred into a spin column containing a silica-based membrane that securely bound the RNA molecules. Packaged RNA was washed a number of times by using the kit's included washing machine in order to get rid of contaminants like proteins, DNA, and lipids. DNase digestion had been performed on the column during the operation in order to prevent contamination with genomic DNA. Lastly, the purified RNA was eluted from RNase-free water and then pooled into sterile tubes for subsequent analyses. The quality and concentration of RNA extracted were checked by two different methods. First, RNA integrity was checked by gel electrophoresis, and the presence of distinct 28S and 18S rRNA bands confirmed a positive RNA class. RNA concentration and purity were measured spectrophotometrically using a Gene Quant 1300 spectrophotometer (Uppsala, Sweden). The absorbance at 260 nm (A260) was used to quantify RNA concentration, while the A260/A280 ratio provided an estimate of RNA purity, with values between 1.8 and 2.0 indicating minimal protein contamination. These steps ensured that the RNA samples were of sufficient quality and quantity for downstream applications such as cDNA synthesis and gene expression.</p>
      </sec>
      <sec>
        <title id="t-d30d4038079d">cDNA Synthesis</title>
        <p id="p-04b2ccb9ce07">First-strand cDNA was synthesized from 4 μg of total RNA as a template, with an oligo (dT)1200 primer and SuperScript™ II RNase H reverse transcriptase (Life Technologies, Breda, The Netherlands) This method targets a poly-A tail a mature upon mRNA did so, ensuring the selection of cDNA from mRNA transcripts. RNA, primer, dNTPs, first-strand buffer, dithiothreitol (DTT), and reverse transcriptase enzyme, prepared in the absence of RNase, in a reaction mixture with a total volume of 20 μL, to prevent RNA degradation or degradation. Initially, the RNA and primer were modified at 65°C for 5 min and then rapidly chilled on ice to minimize secondary products that could interfere with reverse transcription. The reverse transcription reaction was performed at 42°C for 60 min, allowing the enzyme to synthesize complementary DNA. After the reaction, the enzyme was inactivated by heat treatment at 70°C for 15 min. The resulting cDNA was stored at −20°C for subsequent gene expression studies, such as quantitative PCR (qPCR). This approach resulted in high-quality and specific cDNA synthesis, providing reliable templates for downstream analysis.</p>
      </sec>
      <sec>
        <title id="t-c4df403530f6">Real-time Quantitative Polymerase Chain Reaction (RT-PCR)</title>
        <p id="p-8c8f05ed161a">RT-PCR amplification was accomplished utilizing 10 µl amplification solutions comprising Power SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA), 300 nM primers, and 8 ng of reverse-transcribed ribonucleic acid. An ABI PRISM 7900 HT detection platform was employed to perform the reactions (Applied Biosystems). Data from PCR reactions that were run at 95°C for 10 minutes (1 cycle), 94°C for 15 seconds, and 60°C for 1 minute (40 cycles) were resolved using the ABI Prism sequence detection system software and the PE Biosystems v17 Sequence Detection Software (Foster City, CA) was employed for quantification. We computed the relative gene expression using the comparative threshold cycle technique. Furthermore, the results were standardized to the glyceraldehyde-3-phosphate dehydrogenase enzyme. The primer sequences are listed in <bold id="s-eaaacbbbe166"><xref id="x-4055c6fcf051" rid="tw-d74dc05994c4" ref-type="table">Table 1</xref></bold>.</p>
        <p id="p-756331761f84"/>
        <table-wrap id="tw-d74dc05994c4" orientation="portrait">
          <label>Table 1</label>
          <caption id="c-fa8316fe2eb0">
            <title id="t-3b429965b1d6">
              <bold id="s-b7810815246d">The oligonucleotide primers sequence of studied genes </bold>
            </title>
          </caption>
          <table id="table-1" rules="rows">
            <colgroup>
              <col width="13.5"/>
              <col width="44.660000000000004"/>
              <col width="41.839999999999996"/>
            </colgroup>
            <tbody id="table-section-1">
              <tr id="table-row-1">
                <td id="table-cell-1" align="left">
                  <p>
                    <bold>
                      <p id="p-ca9619734fea">Gene</p>
                    </bold>
                  </p>
                </td>
                <td id="table-cell-2" align="left">
                  <p>
                    <bold>
                      <p id="p-b4311c135bb3">Forward primer</p>
                      <p id="p-5549d4f1b287">(5' ------ 3') </p>
                    </bold>
                  </p>
                </td>
                <td id="table-cell-3" align="left">
                  <p>
                    <bold>
                      <p id="p-77e62814c988">Reverse primer</p>
                      <p id="p-7ac320d27b15">(5' ------ 3') </p>
                    </bold>
                  </p>
                </td>
              </tr>
              <tr id="table-row-2">
                <td id="table-cell-4" align="left">
                  <p>
                    <italic>
                      <p id="p-f259f9038475">BCL2</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-5" align="left">
                  <p id="p-cebedcb2c368">AGGAAGTGAACATTTCGGTGAC</p>
                </td>
                <td id="table-cell-6" align="left">
                  <p id="p-e57d2f9e52a8">GCTCAGTTCCAGGACCAGGC</p>
                </td>
              </tr>
              <tr id="table-row-3">
                <td id="table-cell-7" align="left">
                  <p>
                    <italic>
                      <p id="p-ce8f8ded1b6d">BAX</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-8" align="left">
                  <p id="p-55f22c4f4393">GTTGCCCTCTTCTACTTTG</p>
                </td>
                <td id="table-cell-9" align="left">
                  <p id="p-7c785b1b2a93">AGCCACCCTGGTCTTG </p>
                </td>
              </tr>
              <tr id="table-row-4">
                <td id="table-cell-10" align="left">
                  <p>
                    <italic>
                      <p id="paragraph-12">P53</p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-11" align="left">
                  <p id="p-a95c1fec5155">TAACAGTTCCTGCATGGGCGGC</p>
                </td>
                <td id="table-cell-12" align="left">
                  <p id="paragraph-14">AGGACAGGCACAAACACGCACC</p>
                </td>
              </tr>
              <tr id="table-row-5">
                <td id="table-cell-13" align="left">
                  <p>
                    <italic>
                      <p id="paragraph-15">NF-κB </p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-14" align="left">
                  <p id="p-478952c15186">TCTCCTCGCTGGAAAAAGAA</p>
                </td>
                <td id="table-cell-15" align="left">
                  <p id="paragraph-17">AATGTGCTGGCTGTGCTTTA</p>
                </td>
              </tr>
              <tr id="table-row-6">
                <td id="table-cell-16" align="left">
                  <p>
                    <italic>
                      <p id="paragraph-18">GAPDH  </p>
                    </italic>
                  </p>
                </td>
                <td id="table-cell-17" align="left">
                  <p id="p-c1ed326e8034">TGCTGGTGCTGAGTATGTCG </p>
                </td>
                <td id="table-cell-18" align="left">
                  <p id="paragraph-20">TTGAGAGCAATGCCAGCC </p>
                </td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p id="p-9e91c57855c0"/>
      </sec>
      <sec>
        <title id="t-89a80d7c60b7">IL6, IL1β, and TNF-α</title>
        <p id="p-354e319e9fd6">ELISA kits were employed to measure cytokine release from COLO-205 cells. The cells were seeded in six-well plates and allowed to adhere for 24 hours. Following this, the cells were treated with <italic id="e-05f3fad49822">A. lappa</italic> extract (100 µg/mL) for 48 hours. The levels of caspase 3, 9, IL-6, IL-1β, and TNF-α in the cell culture supernatants were quantified using ELISA kits (R&amp;D Systems, Minneapolis, MN, USA) according to the manufacturer’s instructions. A chromogenic substrate was used to develop the color reaction, and the optical density (OD) was measured at 495 nm using a microplate reader.</p>
      </sec>
      <sec>
        <title id="t-9c0337ad34b2">Comet Assay</title>
        <p id="p-3e97669304de">The comet assay was conducted to detect DNA damage resulting from treatments<bold id="s-b488047f0452"><xref id="x-5b83971e7cb5" rid="R263386632911320" ref-type="bibr">16</xref></bold>. After flushing the cells with 3 mL of PBS, the cell solution underwent filtration with a 150-µm bolting cloth. Following the combination of 25 µL of cell suspension with 250 µL of melted low-melting-point agarose in a 1:10 ratio, 75 µL of the resulting mixture was applied evenly onto the slides. Once the gel had set for 20 minutes at 4.0°C, the slides were placed within a tank containing a lysis solution (0.1 M EDTA, 2.5 M NaCl, 10.0 mM Tris base, 1% Triton X-100, and 1% sodium lauroyl sarcosinate) and left for 1 hour at 4.0°C in darkness. After applying three washes with neutralization solution (0.4 M Tris, pH 7.5) to the slides, they were placed at room temperature for 30 minutes in a new alkaline buffer (1.0 mM EDTA and 0.3 M NaOH, pH &gt;13) to facilitate DNA unwinding. Electrophoresis was performed at ambient temperature for 30 minutes utilizing a chilled alkaline buffer (1V/cm; 300 mA). The slides were then carefully rinsed three times in a neutralizing buffer for 5 minutes each before being subjected to 70% ethanol for 5 minutes. After allowing the slides to dry at room temperature, 25 µL of ethidium bromide solution (20 µg/ml) was applied for staining, and the slides were then covered.</p>
      </sec>
      <sec>
        <title id="t-84eac35a447e">Molecular Docking</title>
        <p id="p-c8de3db47657">The X-ray crystal structure of the Homo sapiens transforming growth factor receptor (TGF-βRI) was obtained from the protein databank depository via http://www.rcsb.org (PDB id: 3FAA) to be docked with the compound under study (Arctigenin) which was acquired from the PubChem database (PubChem CID: 64981) via https://pubchem.ncbi.nlm.nih.gov. The protein structure was ready for docking upon eliminating water molecules and the co-crystallized inhibitor (2-aminoimidazole). Hydrogen was added, and protein structure was stored into a PDB format employing Biovia Discovery Studio 2021. The arctigenin was docked against TGF-βRI (PDB id: 3FAA) within a cavity space defined by the coordinates (x: 75.1939, y: 28.8968, z: 92.6845). The docking was executed utilizing Autodock Vina with the PyRx 0.8 graphical user interface software.</p>
      </sec>
      <sec>
        <title id="t-96b67e3f8d02">Statistical Analysis</title>
        <p id="p-0790c8e93fd0">Data were expressed as the mean ± standard error of the mean (SEM) and analyzed using one-way analysis of variance (ANOVA) to determine statistical significance. For multiple comparisons, Tukey–Kramer’s post hoc test was employed to identify significant differences between groups. A p-value of less than 0.05 (p &lt; 0.05) was considered statistically significant. All statistical analyses were performed using the Statistical Analysis System (SAS) software, version 9.0.</p>
        <p id="p-6a97aa5e20c7"/>
        <p id="p-15ba0c35be28"/>
        <table-wrap id="tw-d00bcd076273" orientation="portrait">
          <label>Table 2</label>
          <caption id="c-e81752f050a8">
            <title id="t-9e17947f4147">
              <bold id="s-23745975726f">Quantification of Polyphenol and Flavonoid Compounds in <italic id="e-5bc8c0d712d1">Arctium lappa</italic> Extract by HPLC</bold>
            </title>
          </caption>
          <table id="t-85447549c96d" rules="rows">
            <colgroup>
              <col width="27.68"/>
              <col width="26.72"/>
              <col width="25.380000000000003"/>
              <col width="20.22"/>
            </colgroup>
            <thead id="table-section-header-a242f7284e5f">
              <tr id="tr-531bf40a4996">
                <th id="tc-c2758e4c98c3" align="left">
                  <p id="p-e13b3a2ee41c">Compound</p>
                </th>
                <th id="tc-700691cdf5a1" align="center">
                  <p id="p-1fc4763717c7">Peak Area</p>
                </th>
                <th id="tc-87e39d1263b9" align="center">
                  <p id="p-0475f26b001a">Concentration (µg/mL)</p>
                </th>
                <th id="tc-d659e8184e46" align="center">
                  <p id="p-a706f4c3c706">Concentration (µg/g)</p>
                </th>
              </tr>
            </thead>
            <tbody id="ts-dcea011389a7">
              <tr id="tr-9e9b3725b981">
                <td id="tc-3bbc7503825d" align="left">
                  <p id="p-88f90a727621">Gallic acid</p>
                </td>
                <td id="tc-1b51507deeee" align="center">
                  <p id="p-f5c821e39cc1">721.37</p>
                </td>
                <td id="tc-134322b847cd" align="center">
                  <p id="p-b52a34632887">44.99</p>
                </td>
                <td id="tc-45b905737158" align="center">
                  <p id="p-0d6c370a77ba">899.86</p>
                </td>
              </tr>
              <tr id="tr-a8ae702cb97c">
                <td id="tc-c5e6ac1c0e3d" align="left">
                  <p id="p-7b8147bff71d">Chlorogenic acid</p>
                </td>
                <td id="tc-66e4574d0476" align="center">
                  <p id="p-6961e939fa69">729.89</p>
                </td>
                <td id="tc-b56a68374336" align="center">
                  <p id="p-b5091bc2a78f">78.41</p>
                </td>
                <td id="tc-b893a3148bda" align="center">
                  <p id="p-30fa61de1c13">1568.14</p>
                </td>
              </tr>
              <tr id="tr-62d3f8b4edec">
                <td id="tc-96269bb53b36" align="left">
                  <p id="p-f73df4189453">Coffeic acid</p>
                </td>
                <td id="tc-88bec8c61eab" align="center">
                  <p id="p-ed3770cb34db">615.31</p>
                </td>
                <td id="tc-46ea673010dc" align="center">
                  <p id="p-e7805df28345">38.73</p>
                </td>
                <td id="tc-fb980b7edd7f" align="center">
                  <p id="p-9ee6d1fb2b04">774.56</p>
                </td>
              </tr>
              <tr id="tr-d34760596aa2">
                <td id="tc-ffdbf0695eda" align="left">
                  <p id="p-06aca6798749">Syringic acid</p>
                </td>
                <td id="tc-b7a7d3ed7141" align="center">
                  <p id="p-600e89ac85cc">30.70</p>
                </td>
                <td id="table-cell-19" align="center">
                  <p id="p-def42e7ccaf4">1.65</p>
                </td>
                <td id="table-cell-20" align="center">
                  <p id="p-40fb6bf0b5d3">32.91</p>
                </td>
              </tr>
              <tr id="tr-3238b355009c">
                <td id="table-cell-21" align="left">
                  <p id="paragraph-21">Rutin</p>
                </td>
                <td id="table-cell-22" align="center">
                  <p id="p-345df2472f7f">506.19</p>
                </td>
                <td id="table-cell-23" align="center">
                  <p id="paragraph-23">63.28</p>
                </td>
                <td id="table-cell-24" align="center">
                  <p id="paragraph-24">1265.52</p>
                </td>
              </tr>
              <tr id="table-row-7">
                <td id="table-cell-25" align="left">
                  <p id="paragraph-25">Ellagic acid</p>
                </td>
                <td id="table-cell-26" align="center">
                  <p id="paragraph-26">147.15</p>
                </td>
                <td id="table-cell-27" align="center">
                  <p id="paragraph-27">14.59</p>
                </td>
                <td id="table-cell-28" align="center">
                  <p id="paragraph-28">291.88</p>
                </td>
              </tr>
              <tr id="table-row-8">
                <td id="table-cell-29" align="left">
                  <p id="paragraph-29">Vanillin</p>
                </td>
                <td id="table-cell-30" align="center">
                  <p id="paragraph-30">88.60</p>
                </td>
                <td id="table-cell-31" align="center">
                  <p id="paragraph-31">2.59</p>
                </td>
                <td id="table-cell-32" align="center">
                  <p id="paragraph-32">51.89</p>
                </td>
              </tr>
              <tr id="table-row-9">
                <td id="table-cell-33" align="left">
                  <p id="paragraph-33">Naringenin</p>
                </td>
                <td id="table-cell-34" align="center">
                  <p id="paragraph-34">44.38</p>
                </td>
                <td id="table-cell-35" align="center">
                  <p id="paragraph-35">3.21</p>
                </td>
                <td id="table-cell-36" align="center">
                  <p id="paragraph-36">64.30</p>
                </td>
              </tr>
              <tr id="table-row-10">
                <td id="table-cell-37" align="left">
                  <p id="paragraph-37">Rosmarinic acid</p>
                </td>
                <td id="table-cell-38" align="center">
                  <p id="paragraph-38">69.72</p>
                </td>
                <td id="table-cell-39" align="center">
                  <p id="paragraph-39">5.77</p>
                </td>
                <td id="table-cell-40" align="center">
                  <p id="paragraph-40">115.32</p>
                </td>
              </tr>
              <tr id="table-row-11">
                <td id="table-cell-41" align="left">
                  <p id="paragraph-41">Daidzein</p>
                </td>
                <td id="table-cell-42" align="center">
                  <p id="paragraph-42">46.78</p>
                </td>
                <td id="table-cell-43" align="center">
                  <p id="paragraph-43">2.31</p>
                </td>
                <td id="table-cell-44" align="center">
                  <p id="paragraph-44">46.20</p>
                </td>
              </tr>
              <tr id="table-row-12">
                <td id="table-cell-45" align="left">
                  <p id="paragraph-45">Querectin</p>
                </td>
                <td id="table-cell-46" align="center">
                  <p id="paragraph-46">6.95</p>
                </td>
                <td id="table-cell-47" align="center">
                  <p id="paragraph-47">0.46</p>
                </td>
                <td id="table-cell-48" align="center">
                  <p id="paragraph-48">9.20</p>
                </td>
              </tr>
              <tr id="table-row-13">
                <td id="table-cell-49" align="left">
                  <p id="paragraph-49">Cinnamic acid</p>
                </td>
                <td id="table-cell-50" align="center">
                  <p id="paragraph-50">2.67</p>
                </td>
                <td id="table-cell-51" align="center">
                  <p id="paragraph-51">0.04</p>
                </td>
                <td id="table-cell-52" align="center">
                  <p id="paragraph-52">0.76</p>
                </td>
              </tr>
              <tr id="table-row-14">
                <td id="table-cell-53" align="left">
                  <p id="paragraph-53">Kaempferol</p>
                </td>
                <td id="table-cell-54" align="center">
                  <p id="paragraph-54">9.34</p>
                </td>
                <td id="table-cell-55" align="center">
                  <p id="paragraph-55">0.52</p>
                </td>
                <td id="table-cell-56" align="center">
                  <p id="paragraph-56">10.43</p>
                </td>
              </tr>
              <tr id="table-row-15">
                <td id="table-cell-57" align="left">
                  <p id="paragraph-57">Hesperetin</p>
                </td>
                <td id="table-cell-58" align="center">
                  <p id="paragraph-58">24.77</p>
                </td>
                <td id="table-cell-59" align="center">
                  <p id="paragraph-59">0.94</p>
                </td>
                <td id="table-cell-60" align="center">
                  <p id="paragraph-60">18.75</p>
                </td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn-group>
              <fn id="f-936ea9d11b73">
                <p id="p-f23df3bf629e"><bold id="s-68b3824717e4">Note</bold>: Concentrations are presented in both µg/mL and µg/g for comprehensive analysis.</p>
              </fn>
            </fn-group>
          </table-wrap-foot>
        </table-wrap>
        <p id="p-cc8bae3e374b"/>
        <fig id="f-b8e5b004e6a3" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 1 </label>
          <caption id="c-aad50105bf2a">
            <title id="t-8208cf5174f8"><bold id="s-3a1a984036bb">HPLC analysis of phenolic and flavonoid compounds in <italic id="e-f1784849b928">A. lappa</italic> extract</bold>. The chromatogram shows the retention times and peak areas of major phenolic and flavonoid compounds in the extract.</title>
            <p id="p-3096f8042adb"><bold id="s-cd79d9ce0a1a">Abbreviation</bold>: <bold id="s-3c836848c0d9">HPLC</bold>: High-Performance Liquid Chromatography</p>
          </caption>
          <graphic id="g-96fb475f095f" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/49698c6c-507d-4027-9480-30b840983e76/image/25a25d34-3210-4b09-a855-53f3e9371ace-u131-1729929860-fig1-rvs.jpg"/>
        </fig>
        <p id="p-7c44e8287503"/>
        <p id="p-7413598b8bc3"/>
      </sec>
    </sec>
    <sec>
      <title id="t-164128711167">Results</title>
      <sec>
        <title id="t-8a6c6cc12c8f">Phytochemical Estimation in <italic id="e-84cb5038c797">A. lappa</italic></title>
        <p id="p-6ce483a6ca0f">The phytochemical analysis of <italic id="e-4799b2f2430c">Arctium lappa</italic> revealed strong antioxidant properties. The ethanol extract exhibited a significant IC₅₀ value of 41.17 ± 1.84 μg/mL for DPPH scavenging activity and an IC₅₀ value of 51.65 ± 1.91 μg/mL for ABTS scavenging activity. Additionally, the extract contained high levels of total flavonoids (118.35 ± 0.62 mg QE/g DW) and total phenolics (124.45 ± 0.88 mg GAE/g DW), indicating a rich antioxidant profile. HPLC analysis identified various polyphenolic and flavonoid compounds in the <italic id="e-fa3340c638b4">A. lappa </italic>extract. The most abundant compounds were chlorogenic acid (1568.14 µg/g), rutin (1265.52 µg/g), and gallic acid (899.86 µg/g). Significant amounts of caffeic acid (774.56 µg/g) were also detected, along with moderate levels of ellagic acid (291.88 µg/g) and rosmarinic acid (115.32 µg/g). These results highlight that <italic id="e-a9a50fdd6b63">A. lappa</italic> is rich in potent antioxidant compounds, particularly chlorogenic acid, rutin, and gallic acid (<bold id="s-45276bda0a85"><xref id="x-c21282cde6eb" rid="tw-d00bcd076273" ref-type="table">Table 2</xref></bold>  and <bold id="s-cae543ca01b6"><xref id="x-de12e372c075" rid="f-b8e5b004e6a3" ref-type="fig">Figure 1</xref></bold>).</p>
        <p id="p-4b759ce901a2"/>
        <p id="p-a59a392f81b4"/>
        <fig id="f-dcad66a5cff9" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 2 </label>
          <caption id="c-866d5cf6858f">
            <title id="t-8439f2aee227"><bold id="s-cd7523c2898b">Effects of <italic id="e-689b27341254">A. lappa</italic> extract on the growth of Colo-205. A) </bold>Untreated Colo-205 cells (Control). Baseline cell viability of Colo-205 cells with no treatment, serving as the control group (100% viability). <bold id="s-3eaa7ed743b8">B</bold>) Colo-205 cells treated with Cisplatin. Dose-dependent inhibition of Colo-205 cell viability following treatment with varying concentrations of cisplatin for 72 hours. <bold id="s-54888bad6a60">C</bold>) Colo-205 cells treated with <italic id="e-bfa8fd6e3800">A. lappa</italic> extract. Dose-dependent inhibition of Colo-205 cell viability following treatment with varying concentrations of <italic id="e-d854b843b7e3">A. lappa</italic> ethanolic extract for 72 hours. <bold id="s-0f0922acbb2d">D</bold>) IC₅₀ values of <italic id="e-1eb9b1f93c87">A. lappa</italic> extract and <bold id="s-adf5f3b3b6f3">E</bold>) cisplatin on Colo-205 cell viability, with cisplatin exhibiting an IC₅₀ value of 8.40 µg/mL and <italic id="e-51621cc802e5">A. lappa</italic> extract showing an IC₅₀ of 11.80 µg/mL, <bold id="s-8f72dc30ac3c">F</bold>) <italic id="e-d1e8e4596329">A. lappa</italic> showed with an IC₅₀ of 1485  µg/mL  for normal HSF, <bold id="s-fb4a42b4eca3">G</bold>) Comparison of cytotoxicity between cisplatin and <italic id="e-c538978018f7">A. lappa</italic> extract on Colo-205 cells. <italic id="e-a472ad1dca7c">A. lappa</italic> showed selective cytotoxicity against Colo-205 cells, <bold id="s-7f2b7edd9bf3">H</bold>) <italic id="e-7bf740de502a">A. lappa</italic> showed with a higher IC₅₀ for normal HSF than for Colo-205 cells. </title>
            <p id="p-d046a2abf340"><bold id="s-b00456523837">Abbreviations</bold>: <bold id="s-74904b9c3711">HSF</bold>: human skin fibroblasts, <bold id="s-637c1d3794b7">IC<sub id="s-2e481e15c8da">50</sub></bold>: Half Maximal Inhibitory Concentration</p>
          </caption>
          <graphic id="g-7de7a96d1828" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/49698c6c-507d-4027-9480-30b840983e76/image/5412a018-8b0b-46b4-8d69-3f134fe77622-u131-1729929860-fig2-rvs.jpg"/>
        </fig>
        <p id="p-044640f83195"/>
        <p id="p-b09fe2d2994f"/>
      </sec>
      <sec>
        <title id="t-72f776f05053">Effects of <italic id="e-d04378df43cd">A. lappa</italic> on the Propagation of Colorectal Cancer Cells <italic id="e-6aeb4285fae5">in vitro</italic></title>
        <p id="p-5b0a751b5be7">The results from the SRB assay demonstrated that <italic id="e-aa9120562825">A. lappa</italic> extract exhibited a strong inhibitory effect on the growth of Colo-205 colorectal cancer cells following treatment for 24, 48, and 72 hours (<bold id="s-7d854950dab9"><xref id="x-cb98892f4654" rid="f-dcad66a5cff9" ref-type="fig">Figure 2</xref></bold> ). The ethanolic extract of <italic id="e-999ea72a59bf">A. lappa</italic> showed significant anti-proliferative activity, with an IC₅₀ value of 11.80 µg/mL, as depicted in <bold id="s-31e68cbf453d"><xref id="x-72ef1586212f" rid="f-dcad66a5cff9" ref-type="fig">Figure 2</xref>A–E</bold>. Notably, a dose-dependent decrease in Colo-205 cell viability was observed with increasing concentrations of <italic id="e-a9df2cd20b25">A. lappa</italic> extract (<bold id="s-f241c9758f63"><xref id="x-c7fb3b346bc5" rid="f-dcad66a5cff9" ref-type="fig">Figure 2</xref></bold><bold id="s-e2de6202b2ef">A–D</bold>). In contrast, <italic id="e-30342cd1a6a2">A. lappa</italic> did not induce cytotoxicity in normal human skin fibroblasts (HSF), with an IC₅₀ value of 1478 µg/mL, suggesting a degree of selectivity for cancer cells. For comparison, the reference anticancer drug cisplatin demonstrated an IC₅₀ value of 8.40 µg/mL against Colo-205 cells, while showing much higher cytotoxicity toward normal cells, with an IC₅₀ value of 645.7 µg/mL (<bold id="s-e554afc62718"><xref id="x-32b9f7d32887" rid="f-dcad66a5cff9" ref-type="fig">Figure 2</xref>F</bold>). These findings highlight the potential of <italic id="e-276c47d89e4c">A. lappa</italic> as a promising anticancer agent with selective cytotoxicity against colorectal cancer cells while sparing normal cells. The results showed that <italic id="e-5c0e70203ea9">A. lappa</italic> has a strong inhibitory effect on Colo-205 human colorectal cancer cells but no toxicity or effects on proliferation in normal cells (HSF) (<bold id="s-ceed0e2a67bc"><xref id="x-75bf0241f896" rid="f-dcad66a5cff9" ref-type="fig">Figure 2</xref></bold> <bold id="s-f7baa376e5cc">A-H</bold>).</p>
        <p id="p-69356e21f7a7"/>
        <p id="p-0f3e4b323631"/>
        <fig id="f-3d97c8a3ac7f" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 3 </label>
          <caption id="c-344a8308d1f0">
            <title id="t-68b149d2c8f3"><bold id="s-52157488ef92">Western blot analysis showing the expression of MMP-2 in Colo-205 cells treated with varying concentrations of <italic id="e-c65b7cf32692">A. lappa</italic> extract for 72 hours</bold>. The bands corresponding to MMP-2 were detected, and the expression level was quantified relative to GAPDH. <bold id="s-9b2cbeac8b2f">A</bold>) Western blot analysis showing the expression of MMP-9 in Colo-205 cells treated with <italic id="e-f249ed7f4aa3">A. lappa</italic> extract. The bands corresponding to MMP-9 were observed, with quantification against the housekeeping protein for normalization. <bold id="s-f852b02f9852">B</bold>) Calculation of MMP-2 and MMP-9 levels based on their molecular weights. Densitometric analysis was performed to quantify the expression of MMP-2 and MMP-9 in treated cells, with values normalized to the loading control. The relative expression of MMP-2 and MMP-9 is shown as fold changes compared to untreated (control) cells.</title>
            <p id="p-da1e81987c43"><bold id="s-a926a4a5abd2">Abbreviations</bold>: <bold id="s-6391642da898">GAPDH</bold>: Glyceraldehyde-3-Phosphate Dehydrogenase, <bold id="s-06ddbb1f2828">MMP</bold>: Matrix Metalloproteinase, <bold id="s-97bec58dc9de">GI, GII, GIII and GIV</bold>: Group I, II, III and IV</p>
          </caption>
          <graphic id="g-331320c492cf" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/49698c6c-507d-4027-9480-30b840983e76/image/71919d80-44ba-45ce-999b-81d53241e64e-upicture1.png"/>
        </fig>
        <p id="p-1d938d9846b3"/>
      </sec>
      <sec>
        <title id="t-7af68de4e351">MMP-2 and MMP-9 Expression</title>
        <p id="p-06cef2056fbd">Western blot analysis specified markedly elevated expressions of MMP-2 and MMP-9 proteins in COLO-205 cells compared to HSF cells. However, when treated with burdock extract, the cells exhibited signs of recovery, as shown in (<bold id="s-5ef7924060b0"><xref id="x-d17e240fc289" rid="f-3d97c8a3ac7f" ref-type="fig">Figure 3</xref></bold>). Western blot analysis was accomplished to appraise the expressions of MMP-2 in COLO-205 cancer cells under treatment conditions (<bold id="s-ac1a812fa82d"><xref id="x-fd0e9f57ea5c" rid="f-3d97c8a3ac7f" ref-type="fig">Figure 3</xref></bold>). Densitometric analysis revealed that control cells exhibited baseline MMP-2 expression (3.28%), with minimal change observed in the <italic id="e-25a25be1d29a">A. lappa</italic>-treated control group (3.47%). Notably, cancer induced a substantial upregulation of MMP-2 expression to 13.94%, corresponding to an approximate 4.25-fold increase relative to control conditions. Treatment with <italic id="e-5a730d3d31a7">A. lappa</italic> resulted in MMP-2 expression levels of 10.23%, reflecting an approximate 1.36-fold reduction in MMP-2 expression compared to untreated conditions. This indicates that <italic id="e-ea01c3b1f3ed">A. lappa</italic> effectively mitigates the elevated MMP-2 levels associated with cancer.</p>
        <p id="p-805e23882831">Western blot analysis was performed to examine Matrix Metalloproteinase-9 (MMP-9) expression levels in COLO-205 cancer cells under treatment conditions (<bold id="s-4ccf53230eea"><xref id="x-c533e517239f" rid="f-3d97c8a3ac7f" ref-type="fig">Figure 3</xref></bold>). Densitometric analysis normalized to β-actin revealed baseline MMP-9 expression in control cells (5.08%). Treatment with <italic id="e-6784d77e0a1b">A. lappa</italic> alone showed a slight increase in MMP-9 expression (6.16%), representing a 1.21-fold increase compared to HSF. Notably, cancer induced a substantial upregulation of MMP-9 expression (15.06%), corresponding to a 2.96-fold increase relative to control conditions. Treatment with <italic id="e-78a62c0e9e3d">A. lappa</italic> resulted in MMP-9 expression levels of 11.24%; this reflects an approximate 1.34-fold reduction in MMP-9 expression compared to untreated conditions.</p>
        <p id="p-d4f66c01284c"/>
        <fig id="f-59c676703beb" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 4 </label>
          <caption id="c-1b4cd418231f">
            <title id="t-512bb4416098">ELISA analysis showing the expression levels of (<bold id="s-6ec2df6ac75e">A</bold>) Caspase-3 and Caspase-9 in Colo-205 cells treated with <italic id="e-16c2b2727ee5">A. lappa</italic> extract. <bold id="s-cadad6fcebc1">B</bold>) Gene Expression analysis of apoptosis-regulatory genes <italic id="e-0eb9a6dfbb76">P53, BAX, BCL-2,</italic> and <italic id="e-fb4db4615d03">NF-κB</italic> in <italic id="e-79e238ef77ee">A. lappa</italic>-treated Colo-205 cells. The expression levels of pro-apoptotic (BAX, P53) and anti-apoptotic (BCL-2) proteins, as well as NF-κB, were assessed. <bold id="s-bfabe0af90f8">C</bold>) Quantification of inflammatory cytokines (TNF-α, IL-1β, and IL-6) in the cell culture supernatants from Colo-205 cells treated with <italic id="e-c987ed33787a">A. lappa</italic> extract, measured by ELISA. The levels of these pro-inflammatory cytokines were quantified and compared to untreated controls. Cytokine concentrations are expressed in pg/mL.</title>
            <p id="p-cd7509b37d29"><bold id="s-f65813eff0b2">Abbreviation</bold>: <bold id="s-6e135f60c4a5">ELISA</bold>: Enzyme-Linked Immunosorbent Assay</p>
          </caption>
          <graphic id="g-edfccdbf1f46" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/49698c6c-507d-4027-9480-30b840983e76/image/a2c17c46-785c-49fc-9ac0-905c6d6d0222-u131-1729929860-fig4r-rvs.jpg"/>
        </fig>
        <p id="p-6ee21d6998b1"/>
        <p id="p-03b54e5310c1"/>
      </sec>
      <sec>
        <title id="t-f9bd5ef54205">Caspase-3 and 9</title>
        <p id="p-d01f282d8745">To further investigate the effects of <italic id="e-ca7e67da899a">A. lappa</italic> treatment, we measured the mRNA levels of pro-apoptotic and anti-apoptotic genes using qRT-PCR in COLO-205 cells, after 24 hours of treatment with <italic id="e-d703de48e90a">A. lappa</italic> at IC₅₀ concentrations. The caspase-3, caspase-9 (<bold id="s-0c5bd35f610e"><xref id="x-29244ab84689" rid="f-59c676703beb" ref-type="fig">Figure 4</xref></bold> <bold id="s-b8194cb0cdfe">A</bold>), P53, and BAX expressions (<bold id="s-102ccfa61c99"><xref id="x-f132ee9507d4" rid="f-59c676703beb" ref-type="fig">Figure 4</xref></bold> <bold id="s-761d31eda145">B</bold>) were upregulated by 4.07, 3.66, 2.69, and 22.44-fold, respectively, following <italic id="e-118e63ef0a06">A. lappa</italic> treatment. In contrast, the mRNA expression of the anti-apoptotic protein BCL-2 was downregulated by 13.33-fold in COLO-205 cell lines after <italic id="e-ba3f40d2f0fc">A. lappa</italic> treatment, as depicted in (<bold id="s-e545d0304b82"><xref id="x-fbddbb6d7056" rid="f-59c676703beb" ref-type="fig">Figure 4</xref></bold> <bold id="s-a23624acc172">B</bold>).</p>
      </sec>
      <sec>
        <title id="t-3e2a25836361"><italic id="e-22534f9e53d1">A. lappa </italic>Inhibited COLO-205 Proliferation through NF-κB <italic id="e-03107f5b5307">In Vitro</italic></title>
        <p id="p-c019da3d9d75">To gain a greater understanding of the mechanisms behind the suppressive effects of<italic id="e-05ab7107e5f6"> A. lappa </italic>on COLO-205 cell growth and migration, we investigated the levels of the NF-κB signaling pathway. The findings revealed a dose-dependent reduction in NF-κB expression following <italic id="e-4397175141c8">A. lappa</italic> treatment, suggesting a potential connection between <italic id="e-193cc067cfd6">A. lappa</italic>'s actions on COLO-205 cells and the NF-κB pathway (<bold id="s-afe722d2c003"><xref id="x-13de3069fb66" rid="f-59c676703beb" ref-type="fig">Figure 4</xref></bold> <bold id="s-3ff39dabb420">B</bold>).</p>
      </sec>
      <sec>
        <title id="t-066c15866e39">TNF-α, IL-1β, and IL-6</title>
        <p id="p-fa9fc0faa1c8"><italic id="e-b873092c584e">A. lappa</italic> induced a significant reduction in the inflammatory cytokines (IL-6, IL-1β, and TNF-α) of the cell supernatant, as shown (<bold id="s-0b9e0d0d82ac"><xref id="x-cb0df79cb625" rid="f-59c676703beb" ref-type="fig">Figure 4</xref></bold> <bold id="s-84e1c416a355">C</bold>). These findings showed that <italic id="e-18b08c0ffb3e">A. lappa</italic> might decrease inflammatory cytokine release from the human COLO-205.</p>
      </sec>
      <sec>
        <title id="t-d1fe8ea3eebb">Comet Assay</title>
        <p id="p-bda1b2672c9a">The comet assay provided critical insights into DNA damage induced by <italic id="e-f41853545f31">Arctium lappa</italic> ethanol extract. At a concentration of 100 µg, the extract significantly altered DNA structural integrity in Colo-205 cells, demonstrating its potent genetic impact. Quantitative analysis revealed a marked increase in DNA migration within comet tails. The tail moment escalated dramatically from 2.03 ± 0.03 in the negative control to 18.88 ± 0.86 after extract treatment. Similarly, DNA migration in comet tails increased from 1.33 ± 0.05% to 4.36 ± 0.33% (<bold id="s-4ba7c8f50d0c"><xref id="x-7e41ed9c2309" rid="tw-f7924019f8b7" ref-type="table">Table 3</xref></bold>  and <bold id="s-885e2aa44d9d"><xref id="x-031098bd13b8" rid="f-af846df764ed" ref-type="fig">Figure 5</xref>A-D</bold>).</p>
        <p id="p-496d667d8990"/>
        <table-wrap id="tw-f7924019f8b7" orientation="portrait">
          <label>Table 3</label>
          <caption id="c-e5bbafe044f6">
            <title id="t-0ae967dfdebe">
              <bold id="s-7d115f5b8c84">Effects of <italic id="e-e55791a01974">Arctium lappa</italic> on Genomic DNA in HSF and COLO-205 Cell Lines</bold>
            </title>
          </caption>
          <table id="t-247a2a585214" rules="rows">
            <colgroup>
              <col width="17.79"/>
              <col width="15.23"/>
              <col width="17.150000000000002"/>
              <col width="18.68"/>
              <col width="16.130000000000003"/>
              <col width="15.02"/>
            </colgroup>
            <tbody id="ts-c45f55b2d109">
              <tr id="tr-d9e3b508af8f">
                <td id="tc-e4b727e493fc" align="left">
                  <p>
                    <bold>
                      <p id="p-01217a9c9109">Groups</p>
                    </bold>
                  </p>
                </td>
                <td id="tc-d7a2338fc621" align="center">
                  <p>
                    <bold>
                      <p id="p-dd0cb12434ce">Normal (GI)</p>
                    </bold>
                  </p>
                </td>
                <td id="tc-ae5fd07622e6" align="center">
                  <p>
                    <bold>
                      <p id="p-333db0966f65"><italic id="e-c0e702511149">A. lappa</italic> (GII) on normal cells</p>
                    </bold>
                  </p>
                </td>
                <td id="tc-5861881e4d77" align="center">
                  <p>
                    <bold>
                      <p id="p-6fd7d889f1b9">COLO- 205 (GIII)</p>
                    </bold>
                  </p>
                </td>
                <td id="tc-e59662e67227" align="center">
                  <p>
                    <bold>
                      <p id="p-a10a39b51f93">Treatment with <italic id="e-e13ff1376690">A. lappa</italic>  (GIV)</p>
                    </bold>
                  </p>
                </td>
                <td id="tc-e129f442ae7c" align="center">
                  <p>
                    <bold>
                      <p id="p-f539110101ac">F value</p>
                    </bold>
                  </p>
                </td>
              </tr>
              <tr id="tr-1cb8eb47656d">
                <td id="tc-71d5c4ff3bec" align="left">
                  <p id="p-6ea8346283f3">Tail DNA (%) </p>
                </td>
                <td id="tc-cd42bf1e1624" align="center">
                  <p id="p-9c220acdca71">1.00 ± 0.02<sup id="s-99950208d81f">c</sup></p>
                </td>
                <td id="tc-2e912094c752" align="center">
                  <p id="p-092af96da9da">0.90 ± 0.02<sup id="s-b73a894d3a1a">b</sup></p>
                </td>
                <td id="tc-7bb812e77c56" align="center">
                  <p id="p-39891e17916f">1.33 ± 0.05<sup id="s-d9cea1a18ee7">ab</sup></p>
                </td>
                <td id="tc-ee0f14e842e0" align="center">
                  <p id="p-aedd0dbf32f9">4.36 ± 0.33<sup id="s-5a27961b933a">a</sup></p>
                </td>
                <td id="tc-0ab46e599798" align="center">
                  <p id="p-8eab98f10407">9.148*</p>
                </td>
              </tr>
              <tr id="tr-cdd1e34ad5e3">
                <td id="tc-531bb66a43f7" align="left">
                  <p id="p-6a6a05bb7ab5">Untailed (%) </p>
                </td>
                <td id="tc-deeb297dd624" align="center">
                  <p id="p-1651ab17e068">96.74 ± 0.52<sup id="s-667ba625f3ef">a</sup></p>
                </td>
                <td id="tc-3506cdc12497" align="center">
                  <p id="p-e223116c79c3">95.82 ± 0.75<sup id="s-306576f6115d">a</sup></p>
                </td>
                <td id="tc-1e4849c3855a" align="center">
                  <p id="p-ae7490628826">92.77 ± 0.59<sup id="s-766c2c10cd3a">b</sup></p>
                </td>
                <td id="tc-6d45700b623d" align="center">
                  <p id="p-8d3f74fbcc2d">78.30 ± 0.89<sup id="s-4ad0e1cd6cb7">c</sup></p>
                </td>
                <td id="tc-6d5fdfa78050" align="center">
                  <p id="p-5d7231f284a2">71.133*</p>
                </td>
              </tr>
              <tr id="tr-df300ceab533">
                <td id="tc-534712d7849c" align="left">
                  <p id="p-b020afe38394">Tail length (µm) </p>
                </td>
                <td id="tc-8dee39cd72ba" align="center">
                  <p id="p-1389fa814db6">1.03 ± 0.03<sup id="s-4aa511b061da">c</sup></p>
                </td>
                <td id="tc-0852a317f13b" align="center">
                  <p id="p-7f72cf052e43">1.00 ± 0.01<sup id="s-0032262eb2c8">c</sup></p>
                </td>
                <td id="tc-f1b3c228132c" align="center">
                  <p id="p-1ae842131909">1.30± 0.02<sup id="s-4a219af6fe52">b</sup></p>
                </td>
                <td id="tc-fb98651f7e25" align="center">
                  <p id="p-1fe1b1eca846">5.90 ± 0.37<sup id="s-fc877af81010">a</sup></p>
                </td>
                <td id="tc-30785e6a089e" align="center">
                  <p id="p-7810cc65196b">27.594*</p>
                </td>
              </tr>
              <tr id="tr-135975854a9c">
                <td id="tc-8d71a40c45fd" align="left">
                  <p id="p-fd5453192add">Tail moment </p>
                </td>
                <td id="tc-4343269f8893" align="center">
                  <p id="p-716821a2d62d">1.26 ± 0.04<sup id="s-2c9c283c9195">c</sup></p>
                </td>
                <td id="tc-326f88874737" align="center">
                  <p id="p-0e63241a8a80">1.54 ± 0.06<sup id="s-bb9c328d6e4c">c</sup></p>
                </td>
                <td id="tc-3680e270885a" align="center">
                  <p id="p-ca23f7b26bea">2.03 ± 0.03<sup id="s-bd42c4a590b2">b</sup></p>
                </td>
                <td id="tc-72fc617111a4" align="center">
                  <p id="p-01c39ac3e518">18.88 ± 0.86<sup id="s-b2c681ac3499">b</sup></p>
                </td>
                <td id="tc-60c649dfaf6f" align="center">
                  <p id="p-db615e804a8f">101.39*</p>
                </td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn-group>
              <fn id="f-3cd5d63e6337">
                <p id="p-513723f5381f">Data are expressed as mean ± SE. Different superscript letters (<sup id="s-f02b201be111">a</sup>, <sup id="s-3ed810ea5677">b</sup>, <sup id="s-f2ea53882a0b">c</sup>) indicate statistically significant differences at P &lt; 0.05, determined by one-way ANOVA followed by Tukey–Kramer post hoc test. F value indicates statistical significance (P &lt; 0.05).</p>
              </fn>
            </fn-group>
          </table-wrap-foot>
        </table-wrap>
        <p id="p-819ccffd1fac"/>
        <p id="p-7594fafe0db9"/>
        <fig id="f-af846df764ed" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 5 </label>
          <caption id="c-589728d4436c">
            <title id="t-76ede2823ff4"><bold id="s-dc88dfb4dd7b">Comet assay for experimental groups</bold>. <bold id="s-4db9d5c1f5b9">A</bold>) Normal cells (human skin fibroblasts), showing baseline DNA integrity, <bold id="s-53438d4b9c05">B</bold>) H-Colo-205 cells, demonstrating baseline DNA damage in colorectal cancer cells;<bold id="s-ffc194e1818b"> C</bold>) Effect of <italic id="e-3955604c80ec">A. lappa</italic> on H-Colo-205 cells, showing DNA fragmentation indicative of apoptosis or genotoxicity induced by the extract; <bold id="s-354f16e593ea">D</bold>) Effect of <italic id="e-32d2697eee23">A. lappa</italic> on HSF cells, showing minimal DNA damage in normal cells, indicating selective toxicity toward cancer cells.</title>
          </caption>
          <graphic id="g-d3495f566e27" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/49698c6c-507d-4027-9480-30b840983e76/image/93b7209c-f886-467d-b3d1-fda860780292-upicture3.png"/>
        </fig>
        <p id="p-0a3c1be7ff36"/>
        <p id="p-0a0130315d7e"/>
        <fig id="f-d04c1257f04a" orientation="portrait" fig-type="graphic" position="anchor">
          <label>Figure 6 </label>
          <caption id="c-2669c4b0507e">
            <title id="t-9563f1ec94d0"><bold id="s-4df93df25c1c">Molecular docking experiment showing the interactions between arctigenin (the active compound from <italic id="e-5a7bcccf1f05">A. lappa</italic>) and TGF-βRI.</bold> 2D and 3D depictions of the binding interactions between arctigenin and the co-crystallized inhibitor with TGF-βRI, illustrating the potential binding sites and affinity of arctigenin as a therapeutic agent targeting the TGF-β receptor. The docking results highlight key interactions that may contribute to the anticancer and anti-inflammatory properties of <italic id="e-ec39b202407d">A. lappa</italic>.</title>
          </caption>
          <graphic id="g-ee7a42666750" xlink:href="https://typeset-prod-media-server.s3.amazonaws.com/article_uploads/49698c6c-507d-4027-9480-30b840983e76/image/a163bf46-10d8-4ce5-a924-f255c7292061-u131-1729929860-fig6-rvs.png"/>
        </fig>
        <p id="p-d3125abf93c2"/>
        <p id="p-f11096e6f279"/>
        <table-wrap id="tw-c4aeaeefdac3" orientation="portrait">
          <label>Table 4</label>
          <caption id="c-a71e3d6ccecc">
            <title id="t-ccc9d548d599">
              <bold id="s-c1764a655dce">Molecular Docking Interactions of Arctigenin with TGF-βRI</bold>
            </title>
          </caption>
          <table id="t-9777e4e236cc" rules="rows">
            <colgroup>
              <col width="21.36"/>
              <col width="22.129999999999995"/>
              <col width="25.400000000000006"/>
              <col width="31.11"/>
            </colgroup>
            <thead id="table-section-header-50a5c336e81f">
              <tr id="tr-9a909b32dc0a">
                <th id="tc-f28dfae6e6f4" align="left">
                  <p id="p-298d550ddee0">Compound</p>
                </th>
                <th id="tc-9f3bf8d55561" align="center">
                  <p id="p-acfe468656c9">Binding Energy (kcal/mol) </p>
                </th>
                <th id="tc-a399a0baf953" align="center">
                  <p id="p-4cf0aae6e0c9">Hydrogen Bonds (Residues) </p>
                </th>
                <th id="tc-7c1173dc01b4" align="center">
                  <p id="p-cc7089c3715c">Residual Interactions </p>
                </th>
              </tr>
            </thead>
            <tbody id="ts-d73b7ab2ac4c">
              <tr id="tr-581bc469d875">
                <td id="tc-5a494d2be02a" align="left">
                  <p id="p-e50db63c63b3">Arctigenin</p>
                </td>
                <td id="tc-99b34074a29c" align="center">
                  <p id="p-92a5d7133962">-8.5</p>
                </td>
                <td id="tc-f810f9884837" align="center">
                  <p id="p-ae40c29614b7">2 (Lys232, Glu245) </p>
                </td>
                <td id="tc-d620afbf585c" align="center">
                  <p id="p-6b4e216b3c94">Val219, Leu340, Phe216, Leu278, Leu260, Lys232</p>
                </td>
              </tr>
              <tr id="tr-47b3a25babbe">
                <td id="tc-bd31bde7a187" align="left">
                  <p id="p-8b183ff2ecb2">Co-crystallized Inhibitor</p>
                </td>
                <td id="tc-fe9f185b66e0" align="center">
                  <p id="p-87cf530fe809">-11.3 </p>
                </td>
                <td id="tc-29545369a587" align="center">
                  <p id="p-f16a0a3ac925">2 (Asp351, His283)</p>
                </td>
                <td id="tc-8f9fb062563c" align="center">
                  <p id="p-06a8f0063ed3">Val219, Leu340, Ala230, Leu260, Tyr249, Ser280, Leu278, Val279 </p>
                </td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn-group>
              <fn id="f-69cf66014bb1">
                <p id="p-892b6069858f"><bold id="s-603ce8f2b735">Note</bold>: Binding energies and interactions were determined through molecular docking studies.</p>
              </fn>
            </fn-group>
          </table-wrap-foot>
        </table-wrap>
        <p id="p-ba658f646b4b"/>
        <p id="p-f9c1f8fb0c79"/>
      </sec>
      <sec>
        <title id="t-24b548a791fb">Molecular Docking Experiment</title>
        <p id="p-6fad0c8f22d6">In the current study, arctigenin from <italic id="e-ef81a6f73ac5">Arctium lappa</italic> demonstrated suppressed cancer development <italic id="e-1b9260c82049">in vitro</italic>. This finding is supported by the <italic id="e-9f4ba41fb0a8">in silico</italic> study results, where arctigenin could bind to the TGF-βR1 cavity similar to its co-crystallized inhibitor, as shown in (<bold id="s-9343f6cc129f"><xref id="x-aca5da908447" rid="f-d04c1257f04a" ref-type="fig">Figure 6</xref></bold> <bold id="s-f6017a1cf675">&amp; <xref id="x-b27dbf259330" rid="tw-c4aeaeefdac3" ref-type="table">Table 4</xref></bold>). Arctigenin formed two hydrogen bonds (residues Glu245 and Lys232 with bond lengths of 2.63 Å and 2.89 Å) within the receptor cavity, stabilizing arctigenin. It also exhibited other interactions like van der Waals and π-π interactions with residues resembling those involved with the co-crystallized inhibitor, such as Leu278, Leu260, Val219, and Lys232. These hydrogen bonds and other interactions collectively contribute to stabilizing arctigenin within the cavity of TGF-βR1, inhibiting its kinase function and subsequently suppressing the signal pathway that induces other genes involved in cancer proliferation.</p>
        <p id="p-2bd17481dd07"/>
      </sec>
    </sec>
    <sec>
      <title id="t-30bf8fb99684">Discussion</title>
      <p id="p-c6d08c11e9fb">The study conducted provides supporting evidence for the potential effectiveness of <italic id="e-5a621105fd7c">Arctium lappa</italic> in combating cancer. The ethanol extract of <italic id="e-4055cf67ec3c">A. lappa</italic> demonstrated noteworthy inhibition of COLO-205 cell growth and proliferation, indicating its potential as an antiproliferative agent. These results are consistent with previous research that has highlighted the anticancer properties of <italic id="e-f3dcf89b3b38">A. lappa</italic>. Particularly promising is the selective cytotoxicity of <italic id="e-973dd333dc32">A. lappa</italic> towards cancer cells, as it exhibited no cytotoxic effects on normal HSF cells, suggesting its specificity in targeting cancerous cells. This selective action is crucial in the development of effective treatments while minimizing harm to healthy cells. Notably, Machado<bold id="s-a940aebea615"><xref id="x-12df8967eda8" rid="R263386632911321" ref-type="bibr">17</xref></bold> discovered that the ethanol (EtOH) extract from <italic id="e-75be7b298ef0">A. lappa </italic>and its ethyl acetate fraction demonstrated a greater suppression of HSF growth compared to other extracts. Similarly, Taleb Agha <italic id="e-cd395139810b">et al</italic>.<bold id="s-f8efaee42cc6"><xref id="x-81170b724433" rid="R263386632911322" ref-type="bibr">18</xref></bold> indicated that the ethyl extract of <italic id="e-96bc1139ea39">A. lappa </italic>substantially reduced MCF-7 proliferation and exhibited antimutagenic activity with an IC<sub id="s-6caedcbe2ead">50</sub> of 50.18 ± 3.66 μg/ml. These outcomes agree with prior research on the anticancer potential of A. lappa.</p>
      <p id="p-af136408d438">In our study, the IC<sub id="s-9ff271fbad74">50</sub> value of the <italic id="e-dc6dc4c4171e">A. lappa</italic> ethanol extract was determined, and it was found that compounds such as lignans, terpenoids, and sterols have varying pharmacological effects on cancer and pathological angiogenesis<bold id="s-d3b4c3264aba"><xref id="x-8aec7e6e7447" rid="R263386632911322" ref-type="bibr">18</xref></bold>. Phytosterols, such as stigmasterol and β-sitosterol, have been shown in numerous investigations to possess anticancer properties through diverse modes of action, including reducing cancer cell development and triggering tumorigenesis or cancer cell death<bold id="s-006a6615c353"><xref id="x-08aaf8e2ea7d" rid="R263386632911323" ref-type="bibr">19</xref></bold>. Therefore, these chemicals could contribute to the anti-proliferative effect of <italic id="e-a3c94ad6105f">A. lappa</italic>. Additionally, the fractionation of polyphenol compounds using HPLC of <italic id="e-80c140c5207e">Arctium lappa</italic> by Ionescu <italic id="e-5af7e3591da4">et al</italic>.<bold id="s-1f543bb42ded"><xref id="x-dcac12ab5767" rid="R263386632911324" ref-type="bibr">20</xref></bold>, exhibited the occurrence of compounds like caffeic acid, ferulic acid, chlorogenic acid, cinaric acid, and cichoric acid, as well as flavone compounds like rutin, quercetin, quercitrin, luteolin, and apigenin.</p>
      <p id="p-29c3d1fbbd7f">The study also delved into the underlying mechanisms through which <italic id="e-dfd8a3cba399">A. lappa</italic> exerts its anticancer effects. The observed downregulation of MMP-2 and MMP-9 expression in COLO-205 cells suggests a potential role of <italic id="e-64d4036b9786">A. lappa</italic> in suppressing tumor metastasis and invasion. MMPs play a critical function in these processes, and inhibiting their activity can be a promising strategy for preventing cancer spread<bold id="s-c33535161301"><xref id="x-7e81f81eb260" rid="R263386632911325" ref-type="bibr">21</xref></bold>. Moreover, regulating the NF-κB signaling pathway by <italic id="e-0c9ac519c87b">A. lappa</italic> further supports its anticancer potential. The reduction in NF-κB expression and subsequent decline in inflammatory cytokines (IL-1β, TNF-α, and IL-6) suggest that <italic id="e-122868739b5c">A. lappa</italic> may possess anti-inflammatory properties<bold id="s-47fb258b632a"><xref rid="R263386632911326" ref-type="bibr">22</xref>, <xref rid="R263386632911327" ref-type="bibr">23</xref></bold>.</p>
      <p id="p-3a294635397e">While genotoxic effects were observed in the comet assay, indicating that the <italic id="e-7457cb2c4b7c">A. lappa</italic> extract induces DNA damage in COLO-205 cells, it is important to note that genotoxicity is desirable in cancer cells as it can contribute to their growth inhibition and destruction<bold id="s-5ab72d4e7ca7"><xref id="x-af679ca1e622" rid="R263386632911328" ref-type="bibr">24</xref></bold>. Nevertheless, additional investigations are necessitated to clarify the specific mechanisms of DNA damage induced by <italic id="e-13ff6531f466">A. lappa</italic>. The presence of arctigenin, a bioactive compound found in <italic id="e-57d766feaaa6">A. lappa</italic>, enhances its potential as an anticancer agent. Arctigenin has been associated with antioxidant, anti-inflammatory, and anticancer properties<bold id="s-68648f6aa6cf"><xref id="x-0fb0f4e6d415" rid="R263386632911329" ref-type="bibr">25</xref></bold>. Molecular docking experiments have verified arctigenin's capacity to inhibit the TGF-βR1 signaling pathway, which is involved in cancer proliferation<bold id="s-f8c618f1bb66"><xref rid="R263386632911330" ref-type="bibr">26</xref>, <xref rid="R263386632911331" ref-type="bibr">27</xref></bold>. This suggests that arctigenin is crucial for the overall anticancer properties of <italic id="e-46f6ef70f94f">A. lappa</italic>. Furthermore, the upregulation of pro-apoptotic genes like <italic id="e-7b00bb11d6fa">P53</italic>, <italic id="e-36e673c26c7b">caspase-3</italic>, <italic id="e-40d2afe23b6f">caspase-9</italic>, and <italic id="e-241985d0ccde">BAX</italic>, along with the downregulation of the anti-apoptotic gene <italic id="e-4cbf01a56314">Bcl-2</italic>, further supports the capacity of <italic id="e-00ee26a4fd64">A. lappa</italic> to promote apoptosis in COLO-205 cells. The regulation of apoptosis is a critical process for controlling cancer cell growth and survival<bold id="s-4fef5ae9038a"><xref rid="R263386632911332" ref-type="bibr">28</xref>, <xref rid="R263386632911333" ref-type="bibr">29</xref></bold>.</p>
      <p id="p-b8ca7fb1ce51">Even though our current <italic id="e-9eaa82237a0b">in vitro</italic> study strongly suggests that <italic id="e-1cdcfd7aa415">Arctium lappa</italic> extract may help fight cancer, we are aware of the limitations of cell-based research. We need more research to fully understand the extract's healing properties, even though the controlled cellular environment was helpful for early mechanistic studies.</p>
      <p id="p-9d428d3cb799">Future research should prioritize <italic id="e-eb01f9864d91">in vivo</italic> testing to validate the current studies and ensure their potential clinical utility. To figure out how the <italic id="e-414aecb720ed">Arctium lappa</italic> extracts fight cancer, we will have to use experimental animals and the newest molecular methods. In particular, we focus on looking at dose-response relationships, possible interactions with other drugs, and carrying out an overall pharmacological assessment.</p>
      <p id="p-319f1cb54eb3">In this context, our study is an important first step in identifying the potential of <italic id="e-8fb5bf74badd">Arctium lappa</italic> as an effective anticancer drug. Since there is room for more research, our goal is to lay the groundwork for future studies that can use the favorable results <italic id="e-10345b98ebe3">in vitro</italic> to focus on cancer therapies in particular. This strategy preserves the scientific rigor of the investigation, acknowledges its clinical relevance and scope for its reproduction, points out the significance of the present results, and prescribes mechanisms for further advancement of the area.</p>
    </sec>
    <sec>
      <title id="t-0d924c0d3bad">Conclusions</title>
      <p id="p-a12ccbcf40d5">The findings suggest that <italic id="e-670dde1a130f">A. lappa</italic> has significant anti-tumor activity and could be a good source of anticancer compounds. Additional investigations are necessary to explore the underlying mechanisms and optimize the use of <italic id="e-b158abb94277">A. lappa</italic> for anticancer therapies.</p>
    </sec>
    <sec>
      <title id="t-ff2858bcc81b">Abbreviations</title>
      <p id="p-7335a5e0e20b"><bold id="strong-1">ABTS</bold>: 2,2′-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid), <bold id="strong-2">ANOVA</bold>: Analysis of Variance, <bold id="strong-3">BAX</bold>: BCL2-Associated X Protein, <bold id="strong-4">BCL-2</bold>: B-cell lymphoma 2, <bold id="strong-5">cDNA</bold>: Complementary DNA, <bold id="strong-6">CO₂</bold>: Carbon dioxide, <bold id="strong-7">CP</bold>: Cisplatin, <bold id="strong-8">DMSO</bold>: Dimethyl sulfoxide, <bold id="strong-9">DPPH</bold>: 1,1-diphenyl-2-picrylhydrazyl, <bold id="strong-10">DTT</bold>: Dithiothreitol, <bold id="strong-11">ECL</bold>: Enhanced Chemiluminescence, <bold id="strong-12">EDTA</bold>: Ethylenediaminetetraacetic acid, <bold id="strong-13">ELISA</bold>: Enzyme-Linked Immunosorbent Assay, <bold id="strong-14">EtOH</bold>: Ethanol, <bold id="strong-15">FBS</bold>: Fetal Bovine Serum, <bold id="strong-16">GAE</bold>: Gallic Acid Equivalents, <bold id="strong-17">HBM8-k562</bold>: Human Bone Marrow Cells (K562 leukemia cell line), <bold id="strong-18">H-COLO-205</bold>: Human Colorectal Carcinoma Cells (Colo-205 cell line), <bold id="strong-19">HMM</bold>: Human Multiple Myeloma, <bold id="strong-20">HPLC</bold>: High-Performance Liquid Chromatography, <bold id="strong-21">HRP</bold>: Horseradish Peroxidase, <bold id="strong-22">HSF</bold>: Human Skin Fibroblast, <bold id="strong-23">HTB-43</bold>: Human Oral Cavity Cancer Cells, <bold id="strong-24">Huh-7</bold>: Human Hepatocellular Carcinoma Cells, <bold id="strong-25">IC₅₀</bold>: Half Maximal Inhibitory Concentration, <bold id="strong-26">IL-1β</bold>: Interleukin-1 Beta, <bold id="strong-27">IL-6</bold>: Interleukin-6, <bold id="strong-28">MMP-2</bold>: Matrix Metalloproteinase-2, <bold id="strong-29">MMP-9</bold>: Matrix Metalloproteinase-9, <bold id="strong-30">NF-κB</bold>: Nuclear Factor Kappa B, <bold id="strong-31">OD</bold>: Optical Density, <bold id="strong-32">P53</bold>: Tumor Protein 53, <bold id="strong-33">PBS</bold>: Phosphate-Buffered Saline, <bold id="strong-34">PCR</bold>: Polymerase Chain Reaction, <bold id="strong-35">PDB</bold>: Protein Data Bank, <bold id="strong-36">qRT-PCR</bold>: Quantitative Reverse Transcription Polymerase Chain Reaction, <bold id="strong-37">RP</bold>: Reducing Power, <bold id="strong-38">SAS</bold>: Statistical Analysis System, <bold id="strong-39">SDS</bold>: Sodium Dodecyl Sulfate, <bold id="strong-40">SEM</bold>: Standard Error of the Mean, <bold id="strong-41">SRB</bold>: Sulforhodamine B, <bold id="strong-42">TBS</bold>: Tris-Buffered Saline, <bold id="strong-43">TBST</bold>: Tris-Buffered Saline with Tween 20, <bold id="strong-44">TCA</bold>: Trichloroacetic Acid, <bold id="strong-45">TEAC</bold>: Trolox Equivalent Antioxidant Capacity, <bold id="strong-46">TEMED</bold>: Tetramethylethylenediamine, <bold id="strong-47">TFC</bold>: Total Flavonoid Content, <bold id="strong-48">TGF-βR1</bold>: Transforming Growth Factor Beta Receptor 1, <bold id="strong-49">TNF-α</bold>: Tumor Necrosis Factor Alpha, <bold id="strong-50">UV-Vis</bold>: Ultraviolet-Visible</p>
    </sec>
    <sec>
      <title id="t-22476e1cbf61">Acknowledgments </title>
      <p id="p-14b682f85a01">The authors are grateful to Nawah Scientific Center, especially for providing the cells and facilitating work.</p>
    </sec>
    <sec>
      <title id="t-16d2fc4b62aa">Author’s contributions</title>
      <p id="p-5e8da81c7112">Ibrahim I. Bondouk and Hosam M. Saleh prepared the extract of <italic id="e-4eeba5c4e1a6">Arctium lappa</italic>. Ibrahim I. Bondouk and Hosam M. Saleh and Mohamad Taha Abdelrahman performed the <italic id="e-3a01bbfb1197">in vitro</italic> experiment on the extract, analyzed the extract phenols, and flavonoid content, and determined the <italic id="e-966f30dba70b">in vitro</italic> antioxidant characteristics. Mohamed Taha Abdelrahman performed the molecular docking experiment. Amal I. Hassan performed the biological experiment on the cells and the statistical data. All authors were involved in the data management, statistics, writing, and reviewing of the manuscript. All authors read and approved the final manuscript. </p>
    </sec>
    <sec>
      <title id="t-05eec4709165">Funding</title>
      <p id="p-73174d538e67">None.</p>
    </sec>
    <sec>
      <title id="t-f4d23dbd43fe">Availability of data and materials</title>
      <p id="paragraph-13">Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.</p>
    </sec>
    <sec>
      <title id="t-cfb714a9470d">Ethics approval and consent to participate</title>
      <p id="paragraph-16">Not applicable. </p>
    </sec>
    <sec>
      <title id="t-eb6c9743fe99">Consent for publication</title>
      <p id="paragraph-19">Not applicable. </p>
    </sec>
    <sec>
      <title id="t-3d3ca94f4951">Competing interests</title>
      <p id="paragraph-22">The authors declare that they have no competing interests.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <title>References</title>
      <ref id="R263386632911305">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rawla</surname>
              <given-names>P.</given-names>
            </name>
            <name>
              <surname>Sunkara</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Barsouk</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Epidemiology of colorectal cancer: incidence, mortality, survival, and risk factors</article-title>
          <source>Przeglad Gastroenterologiczny</source>
          <year>2019</year>
          <volume>14</volume>
          <issue>2</issue>
          <fpage>89</fpage>
          <lpage>103</lpage>
          <issn>1895-5770</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.5114/pg.2018.81072</pub-id>
          <pub-id pub-id-type="pmid">31616522</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911306">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Fontana</surname>
              <given-names>P.D.</given-names>
            </name>
            <name>
              <surname>Bavia</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Bovo</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>de Souza</surname>
              <given-names>A.R.</given-names>
            </name>
            <name>
              <surname>Corazza</surname>
              <given-names>M.L.</given-names>
            </name>
            <name>
              <surname>Messias-Reason</surname>
              <given-names>I.J.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Supercritical Extracts from Arctium lappa as a Potential Inhibitor for the Activation of Complement System</article-title>
          <source>Planta Medica International Open</source>
          <year>2019</year>
          <volume>6</volume>
          <issue>02</issue>
          <fpage>e63</fpage>
          <lpage>9</lpage>
          <issn>2509-9264</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1055/a-1025-0085</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911307">
        <element-citation publication-type="misc">
          <person-group person-group-type="author">
            <name>
              <surname>Siddiqui</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Amin</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Alshammary</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Afroze</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Shaikh</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Rathore</surname>
              <given-names>H.A.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Burden of Cancer in the Arab World. In: Laher, I. (eds) Handbook of Healthcare in the Arab World. Springer, Cham</article-title>
          <fpage>495</fpage>
          <lpage>519</lpage>
          <publisher-name>Handb Healthc Arab World</publisher-name>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/978-3-030-36811-1_182</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911308">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ayipo</surname>
              <given-names>Y.O.</given-names>
            </name>
            <name>
              <surname>Chong</surname>
              <given-names>C.F.</given-names>
            </name>
            <name>
              <surname>Abdulameed</surname>
              <given-names>H.T.</given-names>
            </name>
            <name>
              <surname>Mordi</surname>
              <given-names>M.N.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Bioactive alkaloidal and phenolic phytochemicals as promising epidrugs for diabetes mellitus 2: A review of recent development</article-title>
          <source>Fitoterapia</source>
          <year>2024</year>
          <volume>175</volume>
          <fpage>105922</fpage>
          <issn>1873-6971</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.fitote.2024.105922</pub-id>
          <pub-id pub-id-type="pmid">38552806</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911309">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Adham</surname>
              <given-names>A. N</given-names>
            </name>
            <name>
              <surname>Hegazy</surname>
              <given-names>M.E. F</given-names>
            </name>
            <name>
              <surname>Naqishbandi</surname>
              <given-names>A.M.</given-names>
            </name>
            <name>
              <surname>Efferth</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>A</surname>
              <given-names>N. Adham</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Induction of apoptosis, autophagy and ferroptosis by Thymus vulgaris and Arctium lappa extract in leukemia and multiple myeloma cell lines</article-title>
          <source>Molecules (Basel, Switzerland)</source>
          <year>2020</year>
          <volume>25</volume>
          <issue>21</issue>
          <fpage>5016</fpage>
          <issn>1420-3049</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/molecules25215016</pub-id>
          <pub-id pub-id-type="pmid">33138135</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911310">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Ali</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Iqbal</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Safdar</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Murtaza</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Mustafa</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Sajjad</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Antioxidant and antibacterial activities of Artemisia absinthium and Citrus paradisi extracts repress viability of aggressive liver cancer cell line</article-title>
          <source>Molecular Biology Reports</source>
          <year>2021</year>
          <volume>48</volume>
          <issue>12</issue>
          <fpage>7703</fpage>
          <lpage>10</lpage>
          <issn>1573-4978</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s11033-021-06777-0</pub-id>
          <pub-id pub-id-type="pmid">34755263</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911311">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kim</surname>
              <given-names>K.H.</given-names>
            </name>
            <name>
              <surname>Tsao</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Yang</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Cui</surname>
              <given-names>S.W.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Phenolic acid profiles and antioxidant activities of wheat bran extracts and the effect of hydrolysis conditions</article-title>
          <source>Food Chemistry</source>
          <year>2006</year>
          <volume>95</volume>
          <issue>3</issue>
          <fpage>466</fpage>
          <lpage>73</lpage>
          <issn>0308-8146</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.foodchem.2005.01.032</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911312">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Atanassova</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Georgieva</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Ivancheva</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Total phenolic and total flavonoid contents, antioxidant capacity and biological contaminants in medicinal herbs</article-title>
          <source>Journal of the University of Chemical Technology &amp; Metallurgy</source>
          <year>2011</year>
          <volume>46</volume>
          <issue>1</issue>
          <fpage>81</fpage>
          <lpage>88</lpage>
        </element-citation>
      </ref>
      <ref id="R263386632911313">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Vázquez</surname>
              <given-names>C.V.</given-names>
            </name>
            <name>
              <surname>Rojas</surname>
              <given-names>M.G.</given-names>
            </name>
            <name>
              <surname>Ramírez</surname>
              <given-names>C.A.</given-names>
            </name>
            <name>
              <surname>Chávez-Servín</surname>
              <given-names>J.L.</given-names>
            </name>
            <name>
              <surname>García-Gasca</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Ferriz Martínez</surname>
              <given-names>R.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Total phenolic compounds in milk from different species. Design of an extraction technique for quantification using the Folin-Ciocalteu method</article-title>
          <source>Food Chemistry</source>
          <year>2015</year>
          <volume>176</volume>
          <fpage>480</fpage>
          <lpage>6</lpage>
          <issn>1873-7072</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.foodchem.2014.12.050</pub-id>
          <pub-id pub-id-type="pmid">25624259</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911314">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Blois</surname>
              <given-names>M.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Antioxidant determinations by the use of a stable free radical</article-title>
          <source>Nature</source>
          <year>1958</year>
          <volume>181</volume>
          <issue>4617</issue>
          <fpage>1199</fpage>
          <lpage>200</lpage>
          <issn>0028-0836</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/1811199a0</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911315">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Arnao</surname>
              <given-names>M.B.</given-names>
            </name>
            <name>
              <surname>Cano</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Alcolea</surname>
              <given-names>J.F.</given-names>
            </name>
            <name>
              <surname>Acosta</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Estimation of free radical-quenching activity of leaf pigment extracts</article-title>
          <source>Phytochemical Analysis</source>
          <year>2001</year>
          <volume>12</volume>
          <issue>2</issue>
          <fpage>138</fpage>
          <lpage>43</lpage>
          <issn>0958-0344</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/pca.571</pub-id>
          <pub-id pub-id-type="pmid">11705243</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911316">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Kuda</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Tsunekawa</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Hishi</surname>
              <given-names>T.</given-names>
            </name>
            <name>
              <surname>Araki</surname>
              <given-names>Y.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Antioxidant properties of driedkayamo-nori', a brown alga Scytosiphon lomentaria (Scytosiphonales, Phaeophyceae)</article-title>
          <source>Food Chemistry</source>
          <year>2005</year>
          <volume>89</volume>
          <issue>4</issue>
          <fpage>617</fpage>
          <lpage>22</lpage>
          <issn>0308-8146</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.foodchem.2004.03.020</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911317">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Burtscher</surname>
              <given-names>M.M.</given-names>
            </name>
            <name>
              <surname>May</surname>
              <given-names>L.A.</given-names>
            </name>
            <name>
              <surname>Downs</surname>
              <given-names>C.A.</given-names>
            </name>
            <name>
              <surname>Bartlett</surname>
              <given-names>T.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Zooxanthellae Viability Assay</article-title>
          <source>Diseases of Coral</source>
          <year>2015</year>
          <fpage>524</fpage>
          <lpage>37</lpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1002/9781118828502.ch39</pub-id>
          <publisher-name>Dis Coral</publisher-name>
        </element-citation>
      </ref>
      <ref id="R263386632911318">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zhang</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Lin</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Jiang</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Wei</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Chen</surname>
              <given-names>G.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Effects of lead and mercury on sulfate-reducing bacterial activity in a biological process for flue gas desulfurization wastewater treatment</article-title>
          <source>Scientific Reports</source>
          <year>2016</year>
          <volume>6</volume>
          <issue>1</issue>
          <fpage>30455</fpage>
          <issn>2045-2322</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1038/srep30455</pub-id>
          <pub-id pub-id-type="pmid">27455890</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911319">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Bonjoch</surname>
              <given-names>N.P.</given-names>
            </name>
            <name>
              <surname>Tamayo</surname>
              <given-names>P.R.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Protein content quantification by Bradford method</article-title>
          <source>InHandbook of plant ecophysiology techniques</source>
          <year>2001</year>
          <fpage>283</fpage>
          <lpage>295</lpage>
        </element-citation>
      </ref>
      <ref id="R263386632911320">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Winer</surname>
              <given-names>J.</given-names>
            </name>
            <name>
              <surname>Jung</surname>
              <given-names>C.K.</given-names>
            </name>
            <name>
              <surname>Shackel</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Williams</surname>
              <given-names>P.M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Development and validation of real-time quantitative reverse transcriptase-polymerase chain reaction for monitoring gene expression in cardiac myocytes in vitro</article-title>
          <source>Analytical Biochemistry</source>
          <year>1999</year>
          <volume>270</volume>
          <issue>1</issue>
          <fpage>41</fpage>
          <lpage>9</lpage>
          <issn>0003-2697</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1006/abio.1999.4085</pub-id>
          <pub-id pub-id-type="pmid">10328763</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911321">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Machado</surname>
              <given-names>F.B.</given-names>
            </name>
            <name>
              <surname>Yamamoto</surname>
              <given-names>R.E.</given-names>
            </name>
            <name>
              <surname>Zanoli</surname>
              <given-names>K.</given-names>
            </name>
            <name>
              <surname>Nocchi</surname>
              <given-names>S.R.</given-names>
            </name>
            <name>
              <surname>Novello</surname>
              <given-names>C.R.</given-names>
            </name>
            <name>
              <surname>Schuquel</surname>
              <given-names>I.T.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Evaluation of the antiproliferative activity of the leaves from Arctium lappa by a bioassay-guided fractionation</article-title>
          <source>Molecules (Basel, Switzerland)</source>
          <year>2012</year>
          <volume>17</volume>
          <issue>2</issue>
          <fpage>1852</fpage>
          <lpage>9</lpage>
          <issn>1420-3049</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/molecules17021852</pub-id>
          <pub-id pub-id-type="pmid">22334063</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911322">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Agha</surname>
              <given-names>M. Taleb</given-names>
            </name>
            <name>
              <surname>Baharetha</surname>
              <given-names>H.M.</given-names>
            </name>
            <name>
              <surname>Al-Mansoub</surname>
              <given-names>M.A.</given-names>
            </name>
            <name>
              <surname>Tabana</surname>
              <given-names>Y.M.</given-names>
            </name>
            <name>
              <surname>Aziz</surname>
              <given-names>N.H. Kaz Abdul</given-names>
            </name>
            <name>
              <surname>Yam</surname>
              <given-names>M.F.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Proapoptotic and antiangiogenic activities of Arctium lappa L. on breast cancer cell lines</article-title>
          <source>Scientifica</source>
          <year>2020</year>
          <volume>2020</volume>
          <issue>1</issue>
          <fpage>7286053</fpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1155/2020/7286053</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911323">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sánchez-Crisóstomo</surname>
              <given-names>I.</given-names>
            </name>
            <name>
              <surname>Fernández-Martínez</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Cariño-Cortés</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Betanzos-Cabrera</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Bobadilla-Lugo</surname>
              <given-names>R.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Phytosterols and triterpenoids for prevention and treatment of metabolic-related liver diseases and hepatocellular carcinoma</article-title>
          <source>Current Pharmaceutical Biotechnology</source>
          <year>2019</year>
          <volume>20</volume>
          <issue>3</issue>
          <fpage>197</fpage>
          <lpage>214</lpage>
          <issn>1873-4316</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.2174/1389201020666190219122357</pub-id>
          <pub-id pub-id-type="pmid">30806308</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911324">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Elghobashy</surname>
              <given-names>K.A.</given-names>
            </name>
            <name>
              <surname>Eldanasoury</surname>
              <given-names>M.M.</given-names>
            </name>
            <name>
              <surname>Elhadary</surname>
              <given-names>A.A.</given-names>
            </name>
            <name>
              <surname>Farid</surname>
              <given-names>M.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Phytochemical constituent, HPLC profiling and antioxidant activity of Passiflora incarnata and Arctium lappa leaves extracts</article-title>
          <source>International Journal of Veterinary Science</source>
          <year>2020</year>
          <volume>9</volume>
          <fpage>42</fpage>
          <lpage>9</lpage>
          <issn>2304-3075</issn>
        </element-citation>
      </ref>
      <ref id="R263386632911325">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Zheng</surname>
              <given-names>R.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>F.</given-names>
            </name>
            <name>
              <surname>Gong</surname>
              <given-names>A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Targeting tumor vascularization: promising strategies for vascular normalization</article-title>
          <source>Journal of Cancer Research and Clinical Oncology</source>
          <year>2021</year>
          <volume>147</volume>
          <issue>9</issue>
          <fpage>2489</fpage>
          <lpage>505</lpage>
          <issn>1432-1335</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1007/s00432-021-03701-8</pub-id>
          <pub-id pub-id-type="pmid">34148156</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911326">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Rossi</surname>
              <given-names>J.F.</given-names>
            </name>
            <name>
              <surname>Lu</surname>
              <given-names>Z.Y.</given-names>
            </name>
            <name>
              <surname>Massart</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Levon</surname>
              <given-names>K.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Dynamic immune/inflammation precision medicine: the good and the bad inflammation in infection and cancer</article-title>
          <source>Frontiers in Immunology</source>
          <year>2021</year>
          <volume>12</volume>
          <fpage>595722</fpage>
          <issn>1664-3224</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fimmu.2021.595722</pub-id>
          <pub-id pub-id-type="pmid">33708198</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911327">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Xiong</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Cui</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Zhou</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Chai</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Jiang</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Ge</surname>
              <given-names>G.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Dehydrocostus lactone inhibits BLM-induced pulmonary fibrosis and inflammation in mice via the JNK and p38 MAPK-mediated NF-κB signaling pathways</article-title>
          <source>International Immunopharmacology</source>
          <year>2021</year>
          <volume>98</volume>
          <fpage>107780</fpage>
          <issn>1878-1705</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.intimp.2021.107780</pub-id>
          <pub-id pub-id-type="pmid">34118645</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911328">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Barabadi</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Najafi</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Samadian</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Azarnezhad</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Vahidi</surname>
              <given-names>H.</given-names>
            </name>
            <name>
              <surname>Mahjoub</surname>
              <given-names>M.A.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>A systematic review of the genotoxicity and antigenotoxicity of biologically synthesized metallic nanomaterials: are green nanoparticles safe enough for clinical marketing?</article-title>
          <source>Medicina (Kaunas, Lithuania)</source>
          <year>2019</year>
          <volume>55</volume>
          <issue>8</issue>
          <fpage>439</fpage>
          <issn>1648-9144</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/medicina55080439</pub-id>
          <pub-id pub-id-type="pmid">31387257</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911329">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Qiao</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Lv</surname>
              <given-names>C.</given-names>
            </name>
            <name>
              <surname>Tao</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Miao</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zhu</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>W.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Arctigenin disrupts NLRP3 inflammasome assembly in colonic macrophages via downregulating fatty acid oxidation to prevent colitis-associated cancer</article-title>
          <source>Cancer Letters</source>
          <year>2020</year>
          <volume>491</volume>
          <fpage>162</fpage>
          <lpage>79</lpage>
          <issn>1872-7980</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1016/j.canlet.2020.08.033</pub-id>
          <pub-id pub-id-type="pmid">32861708</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911330">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Lahn</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Kloeker</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Berry</surname>
              <given-names>B.S.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>TGF-β inhibitors for the treatment of cancer</article-title>
          <source>Expert Opinion on Investigational Drugs</source>
          <year>2005</year>
          <volume>14</volume>
          <issue>6</issue>
          <fpage>629</fpage>
          <lpage>43</lpage>
          <issn>1744-7658</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.1517/13543784.14.6.629</pub-id>
          <pub-id pub-id-type="pmid">16004592</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911331">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Wang</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Pu</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Wang</surname>
              <given-names>X.</given-names>
            </name>
            <name>
              <surname>Guo</surname>
              <given-names>L.</given-names>
            </name>
            <name>
              <surname>Zhang</surname>
              <given-names>L.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Ameliorative Effects of Arctigenin on Pulmonary Fibrosis Induced by Bleomycin via the Antioxidant Activity</article-title>
          <source>Oxidative Medicine and Cellular Longevity.</source>
          <year>2022</year>
          <volume>2022</volume>
          <issue>1</issue>
          <fpage>3541731</fpage>
          <pub-id pub-id-type="doi">https://doi.org/10.1155/2022/3541731</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911332">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Sun</surname>
              <given-names>Y.</given-names>
            </name>
            <name>
              <surname>Tan</surname>
              <given-names>Y.J.</given-names>
            </name>
            <name>
              <surname>Lu</surname>
              <given-names>Z.Z.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>B.B.</given-names>
            </name>
            <name>
              <surname>Sun</surname>
              <given-names>C.H.</given-names>
            </name>
            <name>
              <surname>Li</surname>
              <given-names>T.</given-names>
            </name>
            <collab/>
            <etal/>
          </person-group>
          <article-title>Arctigenin Inhibits Liver Cancer Tumorigenesis by Inhibiting Gankyrin Expression via C/EBPα and PPARα</article-title>
          <source>Frontiers in Pharmacology</source>
          <year>2018</year>
          <volume>2018</volume>
          <fpage>268</fpage>
          <pub-id pub-id-type="doi">https://doi.org/10.3389/fphar.2018.00268</pub-id>
        </element-citation>
      </ref>
      <ref id="R263386632911333">
        <element-citation publication-type="journal">
          <person-group person-group-type="author">
            <name>
              <surname>Patergnani</surname>
              <given-names>S.</given-names>
            </name>
            <name>
              <surname>Danese</surname>
              <given-names>A.</given-names>
            </name>
            <name>
              <surname>Bouhamida</surname>
              <given-names>E.</given-names>
            </name>
            <name>
              <surname>Aguiari</surname>
              <given-names>G.</given-names>
            </name>
            <name>
              <surname>Previati</surname>
              <given-names>M.</given-names>
            </name>
            <name>
              <surname>Pinton</surname>
              <given-names>P.</given-names>
            </name>
            <collab/>
          </person-group>
          <article-title>Various aspects of calcium signaling in the regulation of apoptosis, autophagy, cell proliferation, and cancer</article-title>
          <source>International Journal of Molecular Sciences</source>
          <year>2020</year>
          <volume>21</volume>
          <issue>21</issue>
          <fpage>8323</fpage>
          <issn>1422-0067</issn>
          <pub-id pub-id-type="doi">https://doi.org/10.3390/ijms21218323</pub-id>
          <pub-id pub-id-type="pmid">33171939</pub-id>
        </element-citation>
      </ref>
    </ref-list>
  </back>
</article>
