Exploratory Transcriptomic Screening and Clinical Validation of Elevated Circulating HERV-K (HML-2)-Associated env Expression in Breast Cancer
- Department of Immunology and Pathophysiology, University of Medicine and Pharmacy, Hue University, Viet Nam
- Department of Microbiology and Institute of Biomedicine, University of Medicine and Pharmacy, Hue University, Hue, Viet Nam
- College of Medicine and Pharmacy, Duy Tan University, Da Nang, Viet Nam
- Medical Laboratory Technology Unit, Medical Technology Department, University of Medicine and Pharmacy, Hue University, Viet Nam
- Department of Microbiology, University of Medicine and Pharmacy, Hue University, Viet Nam
- Oncology Department, University of Medicine and Pharmacy, Hue University, Viet Nam
Abstract
Background: Human endogenous retrovirus K (HERV-K, HML-2) is among the most transcriptionally active endogenous retroviral families and has been implicated in breast cancer (BC) pathogenesis. This study aimed to explore HERV-K (HML-2)-associated env expression and evaluate its utility as a potential non-invasive circulating biomarker for BC.
Methods: Public RNA-seq data from breast epithelial transformation models (GSE84275) were screened to identify dysregulated HERV-K (HML-2)-associated env signals. An upregulated HERV-K (HML-2)-associated env signal overlapping the chromosome 4p16.1 region was prioritized for clinical evaluation. Peripheral family-level HERV-K (HML-2)-associated env expression was subsequently quantified by quantitative real-time PCR (qRT-PCR) in peripheral blood leukocytes obtained from 56 BC patients and 45 healthy controls.
Results: Peripheral HERV-K (HML-2)-associated env expression was significantly higher in BC patients than in healthy controls (median: 0.9111 vs. 0.5284, P = 0.0003). Receiver operating characteristic (ROC) curve analysis demonstrated moderate discriminatory performance (area under the curve [AUC] = 0.7075, 95% CI: 0.6051–0.8100, P = 0.0005). Expression levels were significantly elevated in early-stage disease (stages I–IIA) compared with advanced stages (P < 0.0001). Multivariable logistic regression analysis confirmed that elevated env-associated expression remained an independent predictor of BC (adjusted OR = 12.66, 95% CI: 3.14–51.02, P < 0.001).
Conclusions: Elevated peripheral HERV-K (HML-2)-associated env expression represents a circulating molecular signal prominently associated with early-stage breast cancer, highlighting its potential utility as a complementary non-invasive diagnostic biomarker.
INTRODUCTION
Human endogenous retroviruses (HERVs) constitute approximately 8% of the human genome and are increasingly recognized as dynamic, functional components of the human transcriptome1,2. Although typically silenced by host epigenetic mechanisms, aberrant HERV activation has been implicated in chronic inflammation, neurodegenerative disorders, and multiple human malignancies3,4,5,6,7.
Among HERV families, HERV-K (HML-2) retains relatively intact open reading frames and represents one of the most transcriptionally active and evolutionary young retroviral groups in the human genome8,9. Elevated HERV-K (HML-2) env expression has been associated with epithelial-to-mesenchymal transition (EMT) and the activation of oncogenic signaling pathways, including the extracellular signal-regulated kinase (ERK) cascade10,11,12. In breast cancer (BC), aberrant HERV-K transcription correlates with genomic instability and aggressive tumor phenotypes13,14,15. However, the diagnostic and biomarker relevance of circulating, leukocyte-derived HERV-K transcriptional signals remains insufficiently characterized.
Breast cancer remains a leading cause of cancer-related morbidity and mortality among women worldwide, characterized by marked molecular and clinical heterogeneity16,17. Although conventional oncogenic signaling cascades have been extensively studied, the contribution of retroelement-associated transcriptional activation to early epithelial transformation is not yet fully elucidated. Advances in high-throughput RNA sequencing (RNA-seq) now facilitate exploratory characterization of repetitive-element transcription during malignant transformation18,19. Integrating transcriptomic screening with clinical validation may therefore clarify the diagnostic potential of peripheral HERV-K (HML-2)-associated env expression signals.
In this study, we screened public RNA-seq data from breast epithelial transformation models (GSE84275) and identified an upregulated HERV-K (HML-2) env-associated sequence overlapping the chromosome 4p16.1 locus (chr4:9,123,514–9,133,075). We subsequently quantified peripheral blood leukocyte-derived HERV-K (HML-2)-associated env expression at the family level in an independent clinical cohort of 56 BC patients and 45 healthy controls, evaluating its diagnostic performance and association with clinicopathological stages.
MATERIALS AND METHODS
Study Design
This study integrated in silico transcriptomic discovery with clinical cohort validation. Public RNA-seq data from dataset GSE8427520 deposited in the Gene Expression Omnibus (GEO)21 were analyzed to prioritize dysregulated HERV-K (HML-2)-associated env signals in breast epithelial transformation models. Subsequently, family-level env expression was quantified via qRT-PCR in peripheral blood samples from BC patients and healthy controls. The clinical diagnostic validation component was conducted and reported in strict accordance with the Standards for Reporting Diagnostic Accuracy (STARD 2015) guidelines (Supplementary File S1).
Transcriptomic Screening Using GEO RNA-seq Data
Normalized RNA-seq data from GSE84275 were retrieved from GEO and evaluated across one non-transformed human mammary epithelial model (HME) and three transformed models (HMLE-Ras, HMLE-Her2, and HCC1954)20. HERV-K (HML-2)-associated env signals were identified based on repetitive element annotations and genomic coordinates overlapping known HERV-K loci. Relative expression differences between transformed and non-transformed models were evaluated descriptively using normalized expression values. Given the exploratory nature and limited sample size of this public dataset, formal hypothesis testing and multiple-testing corrections were not performed; the dataset was utilized primarily for candidate prioritization. The HERV-K (HML-2)-associated env signal overlapping chromosome 4p16.1 (chr4:9,123,514–9,133,075) demonstrated consistent upregulation across transformed models and was selected for clinical validation. Genomic coordinates were mapped to the GRCh38/hg38 reference assembly via the UCSC Genome Browser22,23.
In Silico Sequence Verification
The candidate HERV-K (HML-2) env-associated sequence was aligned against the human reference genome using BLASTn (NCBI) to verify sequence similarity and genomic overlap. Annotated genes situated within ±500 kb of the overlapping genomic region were extracted from the UCSC Table Browser using GENCODE v46 annotations24. Given the multicopy nature of HERV-K (HML-2) proviruses, this analysis was intended to confirm family-level sequence identity and genomic context rather than definitive locus-specific transcriptional assignment25.
Study Participants
Female patients with primary breast cancer were prospectively recruited from Hue University of Medicine and Pharmacy Hospital between January 2025 and January 2026. Diagnoses were histopathologically confirmed, and anatomical tumor staging was classified according to the American Joint Committee on Cancer (AJCC) TNM staging manual (8th edition)26. Early-stage disease was defined as stages I to IIA, and advanced-stage disease was defined as stages IIB to IV27.
Inclusion criteria were: (1) female sex aged ≥30 years; (2) histopathologically confirmed primary breast carcinoma; and (3) no prior history of systemic chemotherapy, radiotherapy, or endocrine therapy before blood collection. Exclusion criteria comprised: (1) previous history of other malignancies; (2) autoimmune or systemic inflammatory disorders; (3) acute infectious episodes within two weeks prior to sampling; and (4) pregnancy or lactation. Age-matched healthy controls were recruited from women undergoing routine annual health check-ups at the same institution during the corresponding timeframe. Control individuals exhibited no history of malignancy, autoimmune disease, or active infection. All participants provided written informed consent. The protocol was approved by the Institutional Ethics Committee of Hue University of Medicine and Pharmacy, Hue University (Approval No. H2025/426) and conducted in accordance with the Declaration of Helsinki (1975).
Clinical Data Collection and Blood Sampling
Baseline demographic characteristics and laboratory parameters, including complete blood counts and fasting blood glucose levels, were collected from electronic medical records. In BC patients, serum concentrations of cancer antigen 15-3 (CA15-3), carcinoembryonic antigen (CEA), and C-reactive protein (CRP) were determined through routine hospital laboratory assays. Fasting peripheral venous blood (4 mL) was collected in the morning: 2 mL in EDTA tubes for leukocyte isolation and RNA extraction, and 2 mL in non-anticoagulated tubes for biochemical testing. Samples were processed within 2 hours of venipuncture. Leukocytes were isolated using red blood cell (RBC) lysis buffer (Solarbio, Beijing, China) and stored at −80 °C until analysis.
RNA Isolation and Quantitative Real-Time PCR
Total RNA was extracted from isolated leukocytes using the AxyPrep Total RNA Miniprep Kit (Axygen, China). RNA concentration and optical purity (A260/A280 ratio) were assessed spectrophotometrically. Reverse transcription was performed using the HiScript® III RT SuperMix kit (Vazyme, China), which incorporates an initial genomic DNA elimination step. Quantitative real-time PCR (qRT-PCR) was executed using SYBR Green chemistry on a StepOne™ Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Reactions were set up in a 20 μL volume containing 2× SYBR Green Master Mix, 0.4 μM forward and reverse primers, cDNA template, and nuclease-free water. All experimental procedures adhered strictly to the Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines.
Target gene specificity was confirmed by post-amplification melting curve analysis, demonstrating single, discrete dissociation peaks (Supplementary Figure S1). Reactions were run in technical duplicates with no-template controls (NTC) and no-reverse-transcriptase (no-RT) controls in each batch. Relative HERV-K (HML-2)-associated env expression was calculated using the comparative 2 method, with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) serving as the internal reference gene28. A single pooled cDNA calibrator derived from five BC patients was included across all runs to ensure batch-to-batch comparability: ΔCt = Ct(env) − Ct(GAPDH), and ΔΔCt = ΔCt(sample) − ΔCt(calibrator). Validated primers targeting conserved HERV-K (HML-2) env family sequences were utilized29 (amplicon size: 166 bp; Table 1).
Oligonucleotide primer sequences used for quantitative real-time PCR (qRT-PCR) amplification of the HERV-K (HML-2)
| Target Gene | Primer | Sequence (5′ → 3′) | Amplicon Size |
|---|---|---|---|
| HERV-K (HML-2) | Forward | GCTGTCTCTTCGGAGCTGTT | 166 bp |
| HERV-K (HML-2) | Reverse | CTGAGGCAATTGCAGGAGTT | 166 bp |
| Forward | CAAGGAGTAAGACCCCTGGAC | 131 bp | |
| Reverse | TCTACATGGCAACTGTGAGGAG | 131 bp |
Statistical Analysis
Statistical analyses were carried out using SPSS 25.0 (IBM Corp., Armonk, NY, USA) and GraphPad Prism 9.0 (GraphPad Software, San Diego, CA, USA). Continuous variables were evaluated for distributional normality using the Shapiro–Wilk test and are presented as mean ± standard deviation (SD) for normally distributed data or median (interquartile range, IQR: 25th–75th percentiles) for non-normally distributed data. The sample size was exploratory and not predetermined.
Differences between two groups were assessed using the independent Student's t-test or the Mann–Whitney U test, as appropriate. Differences among three or more groups were evaluated using the Kruskal–Wallis test followed by Dunn's post hoc multiple comparisons test. Binary logistic regression analysis was conducted to identify factors independently associated with breast cancer. Multicollinearity among independent variables was assessed using variance inflation factor (VIF) and tolerance metrics. Receiver operating characteristic (ROC) curve analysis was performed to determine diagnostic accuracy, reporting the area under the curve (AUC) and 95% confidence intervals (CI). All statistical tests were two-tailed, and P < 0.05 was defined as statistically significant.
RESULTS
Transcriptomic Screening Identifies Upregulation of HERV-K (HML-2) env in Transformed Breast Epithelial Models
Exploratory screening of normalized RNA-seq profiles from GSE84275 demonstrated marked transcriptional elevation of an HERV-K (HML-2) env-associated signal overlapping the genomic interval chr4:9,123,514–9,133,075 in transformed breast epithelial cell lines (HMLE-Ras, HMLE-Her2, and HCC1954) relative to non-transformed mammary epithelial cells (HME). These transcriptomic findings served as a hypothesis-generating basis for clinical evaluation in patient-derived peripheral blood samples.
In Silico Verification Confirms Genomic Localization of the Prioritized HERV-K (HML-2) env Sequence
BLASTn alignment of the candidate sequence revealed 100% identity (7,836/7,836 bp, 0 gaps, E-value = 0.0) against the human reference provirus HERV-K (HML-2) sequence (JN675026.1; Supplementary Figure S2), corresponding to the HML-2_4p16.1a locus at chromosome 4p16.1 (chr4:9,123,514–9,133,075)20. Because HERV-K elements exhibit high sequence paralogy, this in silico confirmation established family-level identity and genomic overlap without inferring exclusive single-locus transcription.
Genomic Context of the Candidate HERV-K (HML-2) Locus
Annotation via the UCSC Genome Browser (GRCh38/hg38) demonstrated that the candidate locus at 4p16.1 possesses a canonical full-length proviral architecture flanked by long terminal repeat (LTR5) sequences (Figure 1), known to harbor potent promoter and enhancer activities30. In addition, interrogation of the ±500 kb flanking region identified several pseudogenes and a microRNA gene (MIR548L2) (Supplementary Table S1).

In silico genomic architecture and structural organization of the prioritized HERV-K (HML-2) locus at chromosome 4p16.1. Representative genomic visualization generated using the UCSC Genome Browser (human reference assembly GRCh38/hg38) showing the candidate region (chr4:9,123,514–9,133,075). The chromosomal ideogram (top) indicates the cytogenetic localization at 4p16.1 (red vertical bar). Annotation tracks display the genomic coordinates (scale: 2 kb), overlapping annotated transcripts from GENCODE v49 (green bars and directional chevron arrows indicating transcriptional orientation), and repetitive DNA elements identified by RepeatMasker (bottom). The prominent flanking long terminal repeat (LTR) elements (gray and black bars) delineate the proviral structure corresponding to the HML-2_4p16.1a insertion.
Baseline Characteristics of Study Participants
A total of 101 female participants, comprising 56 BC patients and 45 age-matched healthy controls, were enrolled. Mean age did not differ significantly between BC patients and controls (51.50 vs. 47.00 years, P = 0.1632), confirming baseline comparability. BC patients exhibited significantly lower red blood cell counts (4.254 ± 0.4212 vs. 4.494 ± 0.2522 × 10/L, P = 0.0011), lower hemoglobin levels (120.9 ± 12.06 vs. 133.6 ± 7.405 g/L, P < 0.0001), and a reduced lymphocyte percentage (28.23 ± 8.498% vs. 33.26 ± 6.312%, P = 0.0013). Conversely, platelet counts were moderately elevated in BC patients (265.5 vs. 235.0 × 10/L, P = 0.0347). Total leukocyte count and fasting blood glucose did not differ between cohorts (all P > 0.05; Table 2, Supplementary Table S2).
Baseline demographic, hematological, and biochemical characteristics of healthy control subjects and breast cancer patients. Continuous variables were tested for normality using the Shapiro–Wilk test. Normally distributed variables are expressed as mean ± standard deviation (SD) and compared using the independent-samples Student's
| Clinical Parameters | Healthy Controls ( | BC Patients ( | Test Statistic ( | |
|---|---|---|---|---|
| Age (years) | 47.00 (39.50 – 62.00) | 51.50 (44.00 – 59.75) | 0.1632 | |
| Red blood cells (×1012/L) | 4.494 ± 0.2522 | 4.254 ± 0.4212 | 0.0011* | |
| Hemoglobin (g/L) | 133.6 ± 7.405 | 120.9 ± 12.06 | <0.0001* | |
| White blood cells (×109/L) | 6.850 (5.970 – 7.780) | 6.445 (5.550 – 7.748) | 0.2078 | |
| Neutrophils (%) | 56.00 (51.02 – 60.75) | 59.70 (54.98 – 65.40) | 0.0209* | |
| Lymphocytes (%) | 33.26 ± 6.312 | 28.23 ± 8.498 | 0.0013* | |
| Platelets (×109/L) | 235.0 (209.0 – 302.5) | 265.5 (219.8 – 315.0) | 0.0347* | |
| Fasting blood glucose (mmol/L) | 5.095 (4.803 – 5.495) | 5.155 (4.868 – 5.963) | 0.3047 |
HERV-K (HML-2)-Associated env Expression is Elevated in Breast Cancer Patients Compared with Healthy Controls
qRT-PCR quantification revealed significantly higher peripheral blood leukocyte HERV-K (HML-2) env expression in BC patients than in healthy controls (median [IQR]: 0.9111 [0.5364–1.312] vs. 0.5284 [0.2848–0.7876], P = 0.0003; Figure 2). The Hodges–Lehmann median difference between cohorts was 0.3173.

Peripheral blood leukocyte HERV-K (HML-2)
Logistic Regression Analysis of Factors Associated with Breast Cancer
Univariate logistic regression revealed that elevated HERV-K (HML-2) env expression (OR = 5.28, 95% CI: 1.90–14.67, P = 0.001), lower lymphocyte percentage (OR = 0.92, 95% CI: 0.86–0.97, P = 0.003), and lower hemoglobin level (OR = 0.87, 95% CI: 0.82–0.92, P < 0.001) were significantly associated with BC. In multivariable logistic regression, elevated env expression remained independently associated with BC (adjusted OR = 12.66, 95% CI: 3.14–51.02, P < 0.001). Patient age also demonstrated an independent association (adjusted OR = 1.05, 95% CI: 1.00–1.10, P = 0.044), while hemoglobin level maintained an inverse association (adjusted OR = 0.85, 95% CI: 0.79–0.91, P < 0.001). Lymphocyte percentage was not significant after adjustment (P = 0.179; Table 3). Multicollinearity diagnostics confirmed acceptable tolerance (0.832–0.996) and VIF values (1.004–1.203; Supplementary Table S3).
Univariate and multivariable binary logistic regression analyses identifying independent factors associated with breast cancer. Univariate logistic regression was performed for individual demographic, hematological, and molecular parameters. Multivariable logistic regression was executed adjusting simultaneously for relative HERV-K (HML-2)
| Variables | Univariate OR | 95% CI | Adjusted OR | 95% CI | ||
|---|---|---|---|---|---|---|
| HERV-K (HML-2) | 5.28 | 1.90 – 14.67 | 0.001* | 12.66 | 3.14 – 51.02 | <0.001* |
| Age (years) | 1.02 | 0.98 – 1.06 | 0.256 | 1.05 | 1.00 – 1.10 | 0.044* |
| Lymphocytes (%) | 0.92 | 0.86 – 0.97 | 0.003* | 0.95 | 0.88 – 1.02 | 0.179 |
| Hemoglobin (g/L) | 0.87 | 0.82 – 0.92 | <0.001* | 0.85 | 0.79 – 0.91 | <0.001* |
Diagnostic Performance of HERV-K (HML-2)-Associated env Expression
ROC curve analysis showed that peripheral HERV-K (HML-2) env expression effectively discriminated BC patients from healthy controls, achieving an AUC of 0.7075 (95% CI: 0.6051–0.8100, P = 0.0005; Figure 3), reflecting moderate diagnostic discriminatory accuracy.

Receiver operating characteristic (ROC) curve evaluating the discriminatory performance of circulating HERV-K (HML-2)
Association Between HERV-K (HML-2)-Associated env Expression and Disease Stage
Stratification of BC patients by disease stage (early-stage [I–IIA], n = 22; advanced-stage [IIB–IV], n = 34; healthy controls, n = 45) demonstrated significant stage-dependent heterogeneity (Kruskal–Wallis H = 21.54, P < 0.0001; Figure 4). Dunn's post hoc analysis indicated that env expression was significantly higher in early-stage BC patients than in healthy controls (adjusted P < 0.0001) and advanced-stage patients (adjusted P = 0.0166). In contrast, advanced-stage patients did not differ significantly from healthy controls (adjusted P = 0.1481). Median expression was highest in early-stage BC (1.087 [0.8586–1.448]), intermediate in advanced-stage BC (0.7196 [0.4563–1.104]), and lowest in controls (0.5284 [0.2848–0.7876]). Conventional markers (CA15-3, CEA, and CRP) did not differ significantly between stages (all P > 0.05; Supplementary Table S4). Clinicopathological characteristics and subtype distributions are summarized in Supplementary Table S5.

Stage-stratified expression of peripheral HERV-K (HML-2)
DISCUSSION
This study combined exploratory transcriptomic screening with clinical validation to evaluate circulating, leukocyte-derived HERV-K (HML-2) env expression in breast cancer. Transcriptomic analysis of cell models identified an upregulated env signal overlapping chromosome 4p16.1. Subsequent clinical qRT-PCR quantification confirmed significantly elevated peripheral env expression in BC patients relative to healthy controls (P = 0.0003), predominantly driven by early-stage disease (stages I–IIA, P < 0.0001). ROC analysis demonstrated moderate diagnostic discrimination (AUC = 0.7075), supporting the potential of circulating retroelement transcription as a complementary biomarker.
These findings align with prior reports documenting HERV-K (HML-2) transcriptional derepression in breast malignancies31,32. However, unlike earlier studies that evaluated HERV-K at the global family level without genomic contextualization, we annotated the candidate locus to chromosome 4p16.1 (HML-2_4p16.1a)20. Because short-read sequencing and conserved primer assays cannot uniquely resolve multicopy retroviral loci25, our quantification reflects family-level env expression contextualized by the 4p16.1 prioritization.
Genomic annotation revealed that the candidate locus is flanked by LTR5 elements containing promoter and enhancer motifs susceptible to epigenetic derepression during oncogenic transformation33,34,35. Oncogenic activation driven by Ras or HER2 signaling triggers global chromatin remodeling, DNA hypomethylation, and retroelement reactivation36,37,38. Thus, elevated peripheral env expression likely mirrors broad systemic epigenetic dysregulation rather than isolated transcription from a single proviral locus.
A central finding is the non-linear, stage-dependent expression pattern: env expression peaked in early-stage BC and declined in advanced disease. During early oncogenesis, acute epigenetic instability and initial anti-tumor immune activation may transiently derepress retroelements across circulating leukocytes39,40. In advanced disease, progressive immune exhaustion, tumor-induced immunosuppression, and altered leukocyte subpopulations may attenuate this response. Importantly, because non-malignant inflammatory disease controls were not evaluated, this signal should be viewed as an indirect systemic reflection of tumor-associated immune-epigenetic remodeling rather than a cancer-specific transcript.
Multivariable logistic regression demonstrated that env expression remained independently associated with BC after controlling for hematological parameters (adjusted OR = 12.66). However, the wide confidence interval (3.14–51.02) reflects estimation uncertainty inherent to exploratory sample sizes, necessitating validation in larger cohorts. Furthermore, while conventional serum markers (CA15-3, CEA, CRP) failed to differentiate early- from advanced-stage disease in our cohort, circulating env expression showed distinct stage sensitivity, highlighting its promise within multi-analyte liquid biopsy panels41.
Several limitations should be noted. First, qRT-PCR primers captured family-level env transcripts; long-read sequencing or targeted locus capture is required for definitive locus-specific attribution. Second, single reference gene normalization (GAPDH) was employed; validating multiple housekeeping genes will enhance quantitative precision28. Third, the cross-sectional cohort was modest, though post hoc power analysis indicated adequate statistical power (86.1%) for stage comparisons (Supplementary Table S6). Finally, mechanistic investigations into causal pathways were beyond the current scope.
CONCLUSION
In conclusion, this study demonstrates that circulating leukocyte-derived HERV-K (HML-2)-associated env expression is significantly increased in breast cancer patients, particularly in early-stage disease. While representing family-level retroelement transcriptional activation, this circulating signal holds promise as a complementary, non-invasive biomarker reflecting tumor-associated epigenetic and immune alterations. Expanded multicenter trials and locus-resolved sequencing are warranted to validate these findings and facilitate clinical translation.
Abbreviations
AJCC: American Joint Committee on Cancer; aOR: Adjusted odds ratio; AUC: Area under the receiver operating characteristic curve; BC: Breast cancer; BLASTn: Basic Local Alignment Search Tool (nucleotide); bp: Base pairs; CA15-3: Cancer antigen 15-3; cDNA: Complementary DNA; CEA: Carcinoembryonic antigen; CI: Confidence interval; CRP: C-reactive protein; Ct: Cycle threshold; EDTA: Ethylenediaminetetraacetic acid; EMT: Epithelial-to-mesenchymal transition; ER: Estrogen receptor; ERK: Extracellular signal-regulated kinase; GAPDH: Glyceraldehyde 3-phosphate dehydrogenase; GEO: Gene Expression Omnibus; GLU: Fasting blood glucose; Hb: Hemoglobin; HER2: Human epidermal growth factor receptor 2; HERV: Human endogenous retrovirus; HERV-K: Human endogenous retrovirus K; HML-2: Human MMTV-like 2; IQR: Interquartile range; LTR: Long terminal repeat; LYM: Lymphocytes; MIQE: Minimum Information for Publication of Quantitative Real-Time PCR Experiments; NEU: Neutrophils; OR: Odds ratio; PLT: Platelets; PR: Progesterone receptor; qRT-PCR: Quantitative reverse transcription polymerase chain reaction; RBC: Red blood cells; RNA-seq: RNA sequencing; ROC: Receiver operating characteristic; SD: Standard deviation; STARD: Standards for Reporting Diagnostic Accuracy; TNBC: Triple-negative breast cancer; TNM: Tumor, Node, Metastasis; UCSC: University of California, Santa Cruz; VIF: Variance inflation factor; WBC: White blood cells.
Acknowledgments
The authors thank the patients and healthy volunteers who participated in this study, as well as the clinical and laboratory staff at Hue University of Medicine and Pharmacy Hospital for their administrative and technical assistance.
Author’s contributions
All authors contributed to study conceptualization, study design, data acquisition, experimental investigation, statistical analysis, and manuscript preparation. All authors read and approved the final manuscript.
Funding
This study was funded by Hue University under grant number DHH2025-04-233.
Availability of data and materials
The datasets generated and analyzed during the current study are available from the corresponding author upon reasonable request. Public transcriptomic RNA-seq datasets are accessible via the NCBI Gene Expression Omnibus repository under accession number GSE84275.
Ethics approval and consent to participate
The study protocol was approved by the Institutional Ethics Committee of Hue University of Medicine and Pharmacy, Hue University (Approval No. H2025/426) and was conducted in accordance with the ethical standards established in the Declaration of Helsinki. All enrolled participants provided written informed consent prior to inclusion.
Consent for publication
Not applicable. No individual personal identifiers or images are included in this manuscript.
Declaration of generative AI and AI-assisted technologies in the writing process
None. Generative AI or AI-assisted technologies were not utilized in the writing or editing of this manuscript.
Competing interests
The authors declare that they have no competing financial or non-financial interests.
