Original Research Open Access Logo

The cytotoxic effect of Vernonia amygdalina Del. extract on myeloid leukemia cells

Nguyen Trung Quan 1 ORCID logo
Bui Thi Kim Ly 2, 3 ORCID logo
Hoang Thanh Chi 3, * ORCID logo
  1. Department of Biology and Biotechnology, University of Science Ho Chi Minh City, Viet Nam
  2. Viet Nam Southern Key Laboratory of Biotechnology, Institute of Fungal Research and Biotechnology, Hanoi
  3. Department of Medicine and Pharmacy, Thu Dau Mot University, Thu Dau Mot City, Binh Duong Province, Viet Nam
Correspondence to: Hoang Thanh Chi, Department of Medicine and Pharmacy, Thu Dau Mot University, Thu Dau Mot City, Binh Duong Province, Viet Nam. ORCID: https://orcid.org/0000-0002-6638-1235. Email: [email protected].
Volume & Issue: Vol. 10 No. 8 (2023) | Page No.: 5855-5863 | DOI: 10.15419/bmrat.v10i8.827
Published: 2023-08-31

Online metrics


Statistics from the website

  • HTML Views: 5777
  • PDF Views: 1557
  • XML Views: 406
  • PDF Views: 1122

Statistics from Dimensions

This article is published with open access by BioMedPress. This article is distributed under the terms of the Creative Commons Attribution License (CC-BY 4.0) which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited. 

Abstract

Introduction: This study aimed to demonstrate the cytotoxic effect of a bitter leaf (Vernonia amygdalina Del.) ethanol extract on myeloid leukemia cells.

Methods: The plant extract was prepared using the maceration method. The toxicity assays used the trypan blue exclusion method. Flow cytometry and reverse transcription PCR methods were used to deduce the mechanism of action.

Results: The V. amygdalina Del. extract strongly affected K562 cells, with a half-maximal inhibitory concentration of 8.78 ? 2.224 ?g/mL. The extract could induce apoptosis and arrest the cell cycle in K562 cells. The extract increased the mRNA levels of caspase 3 (CASP3), baculoviral IAP repeat containing 5 (BIRC5/survivin), and phosphatidylinositol 3-kinase (PI3K) and decreased the mRNA levels of retinoblastoma transcriptional corepressor 1 (RB1/pRB), B cell lymphoma/leukemic 2 (BCL2), BCL2-like 1 (BCL2L1/BCL-XL), caspase 9 (CASP9), and the breakpoint cluster region (BCR)-Abelson (ABL) fusion gene.

Conclusion: The V. amygdalina Del. extract strongly inhibited the acute myeloid leukemia cell line K562. It was found to arrest the cell cycle and induce apoptosis by regulating the expression of related genes that predicted targeting BCR-ABL downregulation.

Introduction

Cancer is a leading cause of mortality worldwide, with >19 million new cases and nearly 10 million deaths1, 2. Unfortunately, cancer cases are expected to increase significantly over the next decade3. The economic burden on patients and their families is enormous, significantly affecting public health, the national economy, and social security4. Therefore, medical research is racing to develop effective cancer treatments to prolong patient lives. However, current treatments remain largely ineffective5. One of the least treatable cancers is leukemia, which causes > 250,000 deaths and nearly 500,000 new diagnoses1, 2. Despite advances in knowledge and medical techniques, leukemia-related mortality remains high6.

Phytochemical compounds are being explored as potential treatments for blood cancer7, 8. Various plant compounds have shown inhibitory effects on leukemia cell proliferation. For example, maytansinoids and their derivatives extracted from inhibited tubulin, alvocidibextracted from inhibited cyclin-dependent kinase 9 (CDK9) activity, and omacetaxine mepesuccinate extracted from has been approved by the US Food and Drug Administration9, 10, 11.

Bitter leaf ( Del.) is among the major sources of compounds with scientifically demonstrated anticancer activity. Bitter leaf extract disrupts the phosphoinositide 3-kinase (PI3K)/protein kinase B (AKT)/mechanistic target of rapamycin (mTOR) signaling pathway, the mitogen-activated protein kinase (MAPK) pathway, and fms-related receptor tyrosine kinase 3 (FLT3) phosphorylation, inhibiting cancer cell proliferation12, 13, 14, 15. Studies have found the bitter leaf to be cytotoxic in breast cancer (half-maximal inhibitory concentration [IC]: MCF-7 = 50.36 µg/mL, 4T1 = 25.04 ± 0.36 µg/mL, and T47D = 59.19 ± 0.55 µg/mL), neuroblastoma (IC: U-87 = 18.80 ± 1.11 µg/mL), prostate cancer (IC: PC-3 = 196.60 µg/mL and DU145 = 40.10 ± 4.30 µg/mL), and acute myeloblastic leukemia (IC: HL-60 = 5.58 µg/mL, THP-1 = 24.17 ± 3.33 µg/mL, MOLM-13 = 11.45 ± 2.12 µg/mL, and MV4-11 = 16.08 ± 1.21 µg/mL) cells16, 17, 18, 19, 20, 21. However, few studies have examined bitter leaf’s effect on leukemia cells, especially chronic myeloid leukemia, one of the four main leukemia groups. Therefore, this study aimed to investigate the cytotoxicity of a bitter leaf ethanol extract on chronic myeloid leukemia cell line K562 and determine its mechanism of action.

Methods

Plant extraction

The bitter leaves were harvested from Xuyen Moc district, Ba Ria–Vung Tau province, Vietnam. Dang Le Anh Tuan, Ph.D., of the Botany Laboratory in the Department of Ecology and Evolutionary Biology, Faculty of Biology and Biotechnology, University of Science, Vietnam National University, Ho Chi Minh City, performed the botanical identification (voucher: PHH0004908; Supplementary Figure 1). After washing and thoroughly drying at 40C, the leaves were ground to a powder, which was then suspended in 96% ethanol (1:10 w/v). The plant extract was collected and rotary evaporated to obtain a crude extract. Dimethyl sulfoxide (DMSO; Sigma-Aldrich, USA) was used to dissolve the crude extract (VAE) into a solution for use, which was stored at −20C until needed.

Cell culture

The human leukemia cell line K562 was obtained from Prof. Yuko Sato (Tokyo, Japan)22, 23. The K562 cells were cultured in Roswell Park Memorial Institute 1640 (RPMI 1640) medium (Sigma-Aldrich, USA) supplemented with 10% inactivated fetal bovine serum (Thermo Fisher Scientific, USA), 100 U/mL penicillin, and 0.1 mg/mL streptomycin (Sigma-Aldrich, USA) at 37C with 5% CO. Fibroblast cells were cultured in Dulbecco’s modified Eagle’s medium (StemCell, Singapore) prepared similarly to RPMI 1640.

Cytotoxicity effect of VAE extract

The toxicity of the VAE on K562 cells was evaluated using the trypan blue exclusion method in a six-well plate24. Briefly, 1500 µL of K562 cells at a density of 2×10 cells/mL was added to each experimental well before the same volume of VAE at 0 to 100 µg/mL was added. The plates were incubated for 72 hours at 37C with 5% CO. Then, cell viability was calculated as the percentage difference between the treated and negative control groups.

The toxicity of the VAE on fibroblasts was determined using the 3-(4 5-dimethylthiazol-2-yl)-2 5-diphenyltetrazolium bromide (MTT) assay (Sigma-Aldrich, USA). Briefly, 100 µL of fibroblasts at a density of 2×10 cells/mL was added to each experimental well and incubated in a cell culture incubator. After 24 hours, 100 µL of the VAE at 0 to 200 µg/mL was added. After 72 hours, the viability of the fibroblasts was measured using the MTT assay.

Untreated cells were used as negative controls. Moreover, the effect of the DMSO (Protide, USA) was evaluated at 0.1%, corresponding to the solvent content in the highest VAE treatment.

Annexin V/PI analysis

K562 cells at a density of 10 cells/mL were exposed to the VAE at 50 and 100 µg/mL. After 24 hours, the K562 cells were collected and washed twice with phosphate-buffered saline (PBS; TBR company, Vietnam). Then, the cells were stained according to the ANNEX100B protocol (BioRad, USA). Briefly, cell pellets were resuspended in 195 µL of 1× binding buffer before adding 5 µL of Annexin V. After incubation for 15 minutes in the dark, the cells were washed with 200 µL of binding buffer and resuspended in 190 µL of binding buffer before adding 10 µL of propidium iodide (PI). The stained cells were analyzed using a BD Accuri C6 Plus Flow Cytometer (BD Biosciences, USA).

mRNA expression analysis

K562 cells at a density of 10 cells/mL were exposed to the VAE at 50 and 100 µg/mL. After 16 hours, the K562 cells were collected and washed with PBS. Next, their RNA was extracted according to the TRIzol reagent guidelines (Thermo Fisher Scientific, USA). Then, mRNA expression was detected using the SensiFAST SYBR No-ROX One-Step Kit (Meridian Bioscience, USA) with the primers listed in Table 1. Gene expression was determined using reverse transcription quantitative PCR and the 2 method25.

Table 1

Primers used for analysis

Gene

Sequences (5’ – 3’)

Reference

TP53

TGTGGAGTATTTGGATGACA

Kang Pa Lee, et al. 26

GAACATGAGTTTTTTATGGC

pRB

ACTCCGTTTTCATGCAGAGACTAA

Deborah L. Burkhart, et al.27

GAGGAATGTGAGGTATTGGTGACA

Bcl-XL

TTGGACAATGGACTGGTTGA

Suresh Kumar, et al.28

GTAGAGTGGATGGTCAGTG

Bcl-2

AAGATTGATGGGATCGTTGC

M. Jaberipour, et al.29

GCGGAACACTTGATTCTGGT

Bax

TGGCAGCTGACATGTTTTCTGAC

Kostas V Floros, et al.30

TCACCCAACCACCCTGGTCTT

Survivin

GTTGCGCTTTCCTTTCTGTC

Sang Il Kim, et al.31

TCTCCGCAGTTTCCTCAAAT

Caspase-3

GAACTGGACTGTGGCATTGA

Sadia Perveen, et al.32

CCTTTGAATTTCGCCAAGAA

Caspase-9

GGTGATGTCGGTGCTCTTGA

IDT, Inc.

CGACTCACGGCAGAAGTTCA

BCR-ABL

CGGGAGCAGCAGAAGAAGTTGTTC

Nga Nguyen, et al.33

CAGGCACGTCAGTGGTGTCTCTGTG

MAPK

TGAAATGACAGGCTACGTGG

Liping Jiang, et al.34

GACTTCATCATAGGTCAGGC

Pi3K

GGTTGTCTGTCAATCGGTGACTGT

Ismael Riquelme, et al.35

GAACTGCAGTGCACCTTTCAAGC

GADPH

GAAGGTGAAGGTCGGAGTC

Qiuying Chen, et al.36

GAAGATGGTGATGGGATTTC

Data Analysis

Experiments were repeated at least three times, and data are presented as mean ± standard deviation. Statistical analyses were conducted using GraphPad Prism software (version 9.0.0) with α = 0.05.

Results

VAE strongly inhibited myelocytic leukemia cells

K562 cell viability was greater with (116.90% ± 16.92%) than without 0.1% DMSO ( = 0.0002). In contrast, 0.1% DMSO did not significantly affect fibroblast viability ( = 0.0786). Therefore, 0.1% DMSO was considered benign for evaluating cell growth (Figure 1). The VAE significantly decreased leukemia cell proliferation but did not significantly affect fibroblast proliferation (Figure 2andSupplemental Figure 2). The IC values for the VAE were 8.78 ± 2.22 µg/mL for K562 cells and > 200 µg/mL for fibroblasts. The effects of VAE on K562 cells were classified as selective based on an estimated selective index (SI) of 22.78.

Figure 1

Cytotoxicity of the DMSO 0.1% on evaluated cell lines. There was no statistically significant difference recorded in the survival rates of fibroblast cells. DMSO 0.1% induced mild proliferative stimulation on the K562 cell line, p-value < 0.0002. Abbreviation: DMSO: Dimethyl sulfoxide

Figure 2

Cytotoxic effect of VAE on evaluated cells. The VAE affected K562 proliferation in a dose-dependent manner. No toxicity of VAE was observed at concentrations below 100 µg/mL in fibroblast cells (p-value > 0.9999). Abbreviations: DMSO: Dimethyl sulfoxide, VAE: Vernonia amygdalina Del. ethanol extract

Figure 3

The VAE induced apoptosis and necrosis on K562. (A) Cell populations positive for PI (PE-A channel) and Annexin V (FITC-A channel) increased under the influence of VAE. (B) K562 cells were induced into early apoptosis (quartile Q1-LR), apoptosis (quartile Q1-UR), and necrosis or late apoptosis (quartile Q1-UL), which increased sharply after the effect of VAE. The effect of VAE at a concentration of 50 µg/mL was more effective than this at 100 µg/mL. Abbreviations: DMSO: Dimethyl sulfoxide, PI: Propidium iodide, VAE: Vernonia amygdalina Del. ethanol extract

Figure 4

The VAE-induced K562 cell cycle arrest. (A) The number of cells in the G0/G1 phase decreased gradually under the influence of VAE, while the number of cells increased in the S and G2/M phases. The effect was recorded in a dose-dependent manner. (B) K562 cells tended to be trapped in the S and G2/M phases. Abbreviations: VAE: Vernonia amygdalina Del. ethanol extract

Figure 5

Examination of the mRNA expression of several genes in K562 cells. Alterations in mRNA expression of genes involved in apoptosis, cell cycle arrest, and the BCR-ABL signaling pathway under the effect of VAE. The extract down-regulated the mRNA expression of pRB, BCl-XL, BCl-2, Bax, Caspase-9, and BCR-ABL, and up-regulated the mRNA expression of Survivin, Caspase-3, and Pi3K. Abbreviations: VAE: Vernonia amygdalina Del. ethanol extract

VAE induced apoptosis in K562 cells

K562 cells were further examined by staining with PI and Annexin V after 24 hours of VAE exposure. Cell death increased with VAE concentration. The percentages of Annexin V-positive and PI-positive cells were higher among cells treated with 50 or 100 µg/mL VAE than among untreated control cells ( < 0.0001). Most cells died due to apoptosis (6.10% ± 0.10% for 50 µg/mL and 6.50% ± 0.44% for 100 µg/mL VAE) or necrosis (5.52% ± 0.50% for 50 µg/mL and 6.59% ± 0.52% for 100 µg/mL VAE; Figure 3). In addition, the VAE tended to arrest cells at G2/M (9.95% ± 0.84% for 50 µg/mL and 10.67% ± 0.40% for 100 µg/mL VAE) or S (2.08% ± 0.07% for 50 µg/mL and 3.26% ± 0.03% for 100 µg/mL VAE) checkpoints since the percentage of cells in these phases increased after exposure in a dose-dependent manner (Figure 4).

VAE regulates mRNA expression in K562 cells

We examined the expression of genes involved in apoptosis, the cell cycle, and breakpoint cluster region (BCR)-Abelson (ABL) pathway signaling (Figure 5). The control group comprised healthy cells at the same density as the experimental groups. When 2 values were compared between the 50 and 100 µg/mL VAE experimental groups, the mRNA levels of the following target genes decreased with increasing VAE concentration: retinoblastoma transcriptional corepressor 1 (/; from 5.59 ± 2.63 to 1.24 ± 0.88), B cell lymphoma-leukemia 2 (; from 1.00 ± 0.46 to 0.60 ± 0.15), BCL2-like 1 (/; from 2.44 ± 0.51 to 1.16 ± 0.61), BCL2-associated X apoptosis regulator (; from 1.75 ± 0.17 to 1.23 ± 0.12), caspase 9 (; from 9.57 ± 1.40 to 2.84 ± 0.32), and the fusion gene (from 2.73 ± 0.13 to 1.84 ± 0.33). In contrast, the mRNA levels of the following target genes increased with increasing VAE concentration: baculoviral IAP repeat containing 5 (/; from 1.04 ± 0.15 to 2.00 ± 0.67), caspase 3 (; from 1.21 ± 0.29 to 1.78 ± 0.51), andfrom 0.71 ± 0.40 to 1.00 ± 0.33). However, VAE did not affect tumor protein p53 () and mRNA levels.

Discussion

DMSO is widely used in herbal pharmacology37. However, DMSO easily permeates cells at high concentrations, causing hemolytic toxicity38, 39. In this study, 0.1% DMSO showed no cytotoxicity, leading to no data distortion. The VAE, which had an IC of 8.78 ± 2.22 µg/mL for the K526 cell line, is a potential cytotoxic crude extract according to the US National Cancer Institute criteria40. Its toxicity has also been reported in several other cancer cell lines16, 17, 18, 19, 20.

A Del. extract was previously reported to have a prominent inhibitory effect on the acute myeloid leukemia cell line HL-60, with an IC of 5.58 µg/mL41. Another Del. extract was reported to have a strong cytotoxic effect on acute myeloid leukemia cell lines THP-1 (IC = 24.17 ± 3.33 µg/mL), MOLM-13 (IC = 11.45 ± 2.12 µg/mL), and MV4-11 (IC = 16.08 ± 1.21 µg/mL). Moreover, a Del. root extract had a remarkably toxic effect in a clinical trial, killing 50%–75% of acute myeloid and lymphocytic leukemia patient-derived tumor cells42. However, leukemic inhibitory activity has also been reported for extracts from other plants of the same genus, such as , which had an IC of 24.20 µg/mL for HL-60 cells43, 44.

Its diversity of phytochemical compounds may contribute to the anti-leukemia effects of Del., including vernodalin, which requires further in-depth research45. Furthermore, the effects of the VAE appear highly selective based on its SI of 22.78, facilitating its further evaluation46. A previous study reported that a VAE could prevent the phosphorylation of FLT3. Inhibiting the FLT3 pathway could reduce cell proliferation and enhance cell death through apoptosis15. Interestingly, Del. induced apoptosis in breast cancer cells by regulating the expression procaspases and the BCL2 family18, 19. In our study, the concomitant increases in PI-positive and Annexin V-positive cells after VAE treatment suggests that VAE induces apoptosis in K562 cells. Moreover, PI stain analysis suggests VAE induces cell cycle arrest in K562 cells, consistet with its reported affects on MCF-7 and MDA-MB-231 cells18, 19.

Decreased expression has been closely associated with cell cycle arrest47. In addition, the decreased expression of genes such as and and the increased expression of were found to promote apoptosis in K562 cells48. Moreover, Del. extract has been shown to prevent tyrosine kinase receptor phosphorylation activity15. We found that the VAE decreased the expression of the fusion gene, suggesting that it injured K562 cells through the BCR-ABL pathway. However, since changes in mRNA levels indirectly reflect changes in the protein levels and activities49, 50, 51, further in-depth research is required to confirm our results at the protein level.

CONCLUSIONS

The Del. ethanol extract showed a potent, selective inhibitory effect on the chronic myeloid leukemia cell line K562. Our results show that its mechanism of action was via apoptosis induction, which evidence suggests is through the BCR-ABL pathway.

Abbreviations

DMSO: Dimethyl sulfoxide, IC50: The half maximal inhibitory concentration, SI: Selective index, VAE: Del. ethanol extract

Acknowledgments

We appreciate Ms. Pham Hoai Linh and Mr. Van Duc Huy for helping with the data analysis.

Author’s contributions

NTQ, BTKL, and HTC designed the study, NTQ performed the experiments and data acquisition, and all authors read and approved the final manuscript.

Funding

This study was funded by the Vietnam National Foundation for Science and Technology Development (grant no. 106.02 2019.50).

Availability of data and materials

Data and materials used and/or analyzed during the current study are available from the corresponding author on reasonable request.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

References

  1. H. Sung, J. Ferlay, R.L. Siegel, M. Laversanne, I. Soerjomataram, A. Jemal. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA: a Cancer Journal for Clinicians 2021; 71(3): 209-49.
  2. . Bộ Y tế. Tình hình Ung thư tại Việt Nam. Cổng thông tin điện tử Bộ Y Tế. 2021. 2021; :
  3. H. Sung, J. Ferlay, R.L. Siegel. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. 2021;71(3):209-49. 2021; :
  4. R.L. Siegel, K.D. Miller, H.E. Fuchs, A. Jemal. Cancer Statistics, 2021. CA: a Cancer Journal for Clinicians 2021; 71(1): 7-33.
  5. J.R. Bauman, J.S. Temel. The integration of early palliative care with oncology care: the time has come for a new tradition. Journal of the National Comprehensive Cancer Network : JNCCN 2014; 12(12): 1763-71.
  6. J. Huang, S.C. Chan, C.H. Ngai, V. Lok, L. Zhang, D.E. Lucero-Prisno. Disease Burden, Risk Factors, and Trends of Leukaemia: A Global Analysis. Frontiers in Oncology 2022; 12: 904292.
  7. R. Hussein, A. El-Anssary. Plants secondary metabolites: The key drivers of the pharmacological actions of medicinal plants, Herbal medicine, Philip F. Builders, IntechOpen. 2019; :
  8. H.I. Lowe, D. Daley-Beckford, N.J. Toyang, C. Watson, S. Hartley, J. Bryant. The Anti-cancer Activity of Vernonia divaricata Sw against Leukaemia, Breast and Prostate Cancers In Vitro. The West Indian Medical Journal 2014; 63(4): 285-8.
  9. W. Kim, C. Whatcott, A. Siddiqui-Jain, S. Anthony, D.J. Bearss, S.L. Warner. The CDK9 Inhibitor, Alvocidib, Potentiates the Non-Clinical Activity of Azacytidine or Decitabine in an MCL-1-Dependent Fashion, Supporting Clinical Exploration of a Decitabine and Alvocidib Combination. Blood 2018; 132(Supplement 1): 4355.
  10. K.T.J. Chen, G.G.C. Militao, M. Anantha, D. Witzigmann, A.W.Y. Leung, M.B. Bally. Development and characterization of a novel flavopiridol formulation for treatment of acute myeloid leukemia. Journal of controlled release : official journal of the Controlled Release Society 2021; 333: 246-57.
  11. J.E. Karp, D.D. Ross, W. Yang, M.L. Tidwell, Y. Wei, J. Greer. Timed sequential therapy of acute leukemia with flavopiridol: in vitro model for a phase I clinical trial. Clinical Cancer Research 2003; 9(1): 307-15.
  12. . Mitina O. Src kinases and Flt3: phosphorylation, interference with receptor maturation and mechanism of association (Doctoral dissertation, lmu).. 2005; :
  13. F. Hayakawa, M. Towatari, H. Kiyoi, M. Tanimoto, T. Kitamura, H. Saito. Tandem-duplicated Flt3 constitutively activates STAT5 and MAP kinase and introduces autonomous cell growth in IL-3-dependent cell lines. Oncogene 2000; 19(5): 624-31.
  14. M. Mizuki, R. Fenski, H. Halfter, I. Matsumura, R. Schmidt, C. Müller. Flt3 mutations from patients with acute myeloid leukemia induce transformation of 32D cells mediated by the Ras and STAT5 pathways. Blood 2000; 96(12): 3907-14.
  15. Chi H.T., Ly B.T.. Screening for the Potent FMS-Like Tyrosine Kinase 3 (FLT3) Inhibitors from Vietnamese Traditional Herbal Medicines. International Journal of Pharmaceutical Research 2022; 13(2): 2890-2900.
  16. W. Johnson, P.B. Tchounwou, C.G. Yedjou. Therapeutic Mechanisms of Vernonia amygdalina Delile in the Treatment of Prostate Cancer. Molecules (Basel, Switzerland) 2017; 22(10): 1594.
  17. L.A. Olufunmilayo , M.J. Oshiobugie , A.I. Iyobosa . Gas chromatography-mass spectrometry (GC-MS) analysis of phytocomponents in the root, stem nark and leaf of Vernonia amygdalina. World Journal of Pharmaceutical Research 2017; 6(2): 35-49.
  18. P.A. Hasibuan, U. Harahap, P. Sitorus, D. Satria. The anticancer activities of Vernonia amygdalina Delile. Leaves on 4T1 breast cancer cells through phosphoinositide 3-kinase (PI3K) pathway. Heliyon 2020; 6(7): e04449.
  19. F.C. Wong, C.C. Woo, A. Hsu, B.K.H. Tan. The anti-cancer activities of Vernonia amygdalina extract in human breast cancer cell lines are mediated through caspase-dependent and p53-independent pathways. PLoS One 2013; 8(10): e78021-e.
  20. J. Joseph, V. Lim, H. Rahman, H. Othman, N. Samad. Anti-cancer effects of Vernonia amygdalina: A systematic review. Tropical Journal of Pharmaceutical Research 2020; 19(8): 1775-84.
  21. N.T. Quân, P.T.M. Tâm, H.K. S, H.T. Chí. Đánh giá tác động gây độc tế bào ung thư máu cấp dòng tuỷ của cao chiết từ cây lá đắng. Tạp chí Khoa học và Công nghệ - Đại học Đà Nẵng 2022; 2022: 49-53 (In Vietnamese).
  22. G. Grosveld, T. Verwoerd, T. van Agthoven, A. de Klein, K.L. Ramachandran, N. Heisterkamp. The chronic myelocytic cell line K562 contains a breakpoint in bcr and produces a chimeric bcr/c-abl transcript. Molecular and Cellular Biology 1986; 6(2): 607-16.
  23. S. Tsuchiya, M. Yamabe, Y. Yamaguchi, Y. Kobayashi, T. Konno, K. Tada. Establishment and characterization of a human acute monocytic leukemia cell line (THP-1). International Journal of Cancer 1980; 26(2): 171-6.
  24. B.T. Ly, H.T. Chi, M. Yamagishi, Y. Kano, Y. Hara, K. Nakano. Inhibition of FLT3 expression by green tea catechins in FLT3 mutated-AML cells. PLoS One 2013; 8(6): e66378.
  25. K.J. Livak, T.D. Schmittgen. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods (San Diego, Calif.) 2001; 25(4): 402-8.
  26. S. Kumar, V.K. Sharma, S. Yadav, S. Dey. Antiproliferative and apoptotic effects of black turtle bean extracts on human breast cancer cell line through extrinsic and intrinsic pathway. Chemistry Central Journal 2017; 11(1): 56.
  27. N.T.H. Nga, P.T. Xinh. Khảo sát đột biến gen BCR/ABL gây kháng Imatinib trên bệnh nhân bạch cầu mạn dòng tuỷ (CML) Bằng phương pháp giải trình tự chuỗi DNA. Bệnh viện Truyền máu Huyết học, Tp. Hồ Chí Minh; 2013.. Đề tài nghiên cứu khoa học Sở Khoa học và Công nghệ Tp. HCM 2013; :
  28. Q. Chen, K. Kirk, Y.I. Shurubor, D. Zhao, A.J. Arreguin, I. Shahi. Rewiring of Glutamine Metabolism Is a Bioenergetic Adaptation of Human Cells with Mitochondrial DNA Mutations. Cell Metabolism 2018; 27(5):
  29. I. Riquelme, O. Tapia, J.A. Espinoza, P. Leal, K. Buchegger, A. Sandoval. The Gene Expression Status of the PI3K/AKT/mTOR Pathway in Gastric Cancer Tissues and Cell Lines. Pathology Oncology Research 2016; 22(4): 797-805.
  30. L. Jiang, Z. Tang. Expression and regulation of the ERK1/2 and p38 MAPK signaling pathways in periodontal tissue remodeling of orthodontic tooth movement. Molecular Medicine Reports 2018; 17(1): 1499-506.
  31. D.L. Burkhart, L.K. Ngai, C.M. Roake, P. Viatour, C. Thangavel, V.M. Ho. Regulation of RB transcription in vivo by RB family members. Molecular and Cellular Biology 2010; 30(7): 1729-45.
  32. S.I. Kim, S.G. Yeo, Y. Gen, H.R. Ju, S.H. Kim, D.C. Park. Differences in autophagy-associated mRNAs in peritoneal fluid of patients with endometriosis and gynecologic cancers. European Journal of Obstetrics & Gynecology and Reproductive Biology 2019; 2: 100016.
  33. K.V. Floros, H. Thomadaki, D. Florou, M. Talieri, A. Scorilas. Alterations in mRNA expression of apoptosis-related genes BCL2, BAX, FAS, caspase-3, and the novel member BCL2L12 after treatment of human leukemic cell line HL60 with the antineoplastic agent etoposide. Annals of the New York Academy of Sciences 2006; 1090(1): 89-97.
  34. M. Jaberipour, M. Habibagahi, A.Z. Hosseini, M. Abbasi, A. Sobhani-lari, A-r Talei. Detection of B cell lymphoma 2, tumor protein 53, and FAS gene transcripts in blood cells of patients with breast cancer. Indian Journal of Cancer 2010; 47(4): 412-7.
  35. K.P. Lee, S. Baek, M.S. Yoon, J.S. Park, B.S. Hong, S.J. Lee. Potential anticancer effect of aspirin and 2'-hydroxy-2,3,5'-trimethoxychalcone-linked polymeric micelles against cervical cancer through apoptosis. Oncology Letters 2022; 23(1): 31.
  36. S. Perveen, H. Ashfaq, M. Shahjahan, A. Manzoor, A. Tayyeb. Citrullus colocynthis regulates de novo lipid biosynthesis in human breast cancer cells. Journal of Cancer Research and Therapeutics 2020; 16(6): 1294-301.
  37. T. Kelava, I. Cavar, F. Culo. Biological actions of drug solvents. Periodicum Biologorum 2011; 113: 311-20.
  38. S.E. Gad, D.W. Sullivan. Dimethyl Sulfoxide (DMSO). Encyclopedia of Toxicology (Third Edition), Academic Press, Oxford 2014, p.166-168. :
  39. H.P. Cell. Hematopoietic Stem Cell Collections and Cellular Therapies. Clinical Principles of Transfusion Medicine. 2018 Feb 5:151.. 2018; : 151-67.
  40. . Boik J. Natural compounds in cancer therapy. Oregon Medical Press, Minnesota, USA, 2001.. 2001; :
  41. E. Iweala, F.F. Liu, R.R. Cheng, Y. Li, C. Omonhinmin, Y.J. Zhang. Anti-Cancer and Free Radical Scavenging Activity of Some Nigerian Food Plants in vitro. International Journal of Cancer Research 2015; 11(1): 41-51.
  42. M.M. Khalafalla, E. Abdellatef, H.M. Daffalla, A.A. Nassrallah, K.M. Aboul-Enein, D.A. Lightfoot. Antileukemia activity from root cultures of Vernonia amygdalina. Journal of Medicinal Plants Research 2009; 3(8): 556-62.
  43. M. Khay, P. Toeng, V. Mahiou-Leddet, F. Mabrouki, K. Sothea, E. Ollivier. HPLC analysis and cytotoxic activity of Vernonia cinerea. Natural Product Communications 2012; 7(10): 1259-62.
  44. E. Thomas, V. Gopalakrishnan, R.R. Somasagara, B. Choudhary, S.C. Raghavan. Extract of Vernonia condensata, Inhibits Tumor Progression and Improves Survival of Tumor-allograft Bearing Mouse. Scientific Reports 2016; 6(1): 23255.
  45. I.I. Ijeh , C.E. Ejike . Current perspectives on the medicinal potentials of Vernonia amygdalina Del. Journal of Medicinal Plants Research 2010; 5(7): 1051-1061.
  46. O.A. Peña-Morán, M.L. Villarreal, L. Álvarez-Berber, A. Meneses-Acosta, V. Rodríguez-López. Cytotoxicity, Post-Treatment Recovery, and Selectivity Analysis of Naturally Occurring Podophyllotoxins from Bursera fagaroides var. fagaroides on Breast Cancer Cell Lines. Molecules (Basel, Switzerland) 2016; 21(8): 1013.
  47. C. Giacinti, A. Giordano. RB and cell cycle progression. Oncogene 2006; 25(38): 5220-7.
  48. S. Fulda, K.M. Debatin. Extrinsic versus intrinsic apoptosis pathways in anticancer chemotherapy. Oncogene 2006; 25(34): 4798-811.
  49. L.W. Barrett, S. Fletcher, S.D. Wilton. Regulation of eukaryotic gene expression by the untranslated gene regions and other non-coding elements. Cellular and Molecular Life Sciences 2012; 69(21): 3613-34.
  50. . Alberts B. Molecular biology of the cell. Garland science; 2017 Aug 7.. :
  51. S. Panda. A Review on Regulation of Gene in Eukaryotes. International Journal of Bioassays 2016; 5(8): 4729.

Comments